1
Supplementary materials
Supplementary Figures
Supplementary Figure 1 Phylogenetic tree of 22 species, based on FTO precursor sequences.
Supplementary Figure 2Linkage disequilibrium (LD) structure of 18 SNPs in the FTO region.
Supplementary Tables
SupplementaryTable 1Primers used in this study
SupplementaryTable 2cDNA database sequences used for phylogenetic analysis
Supplementary Table 3 Genetic variations identified in 8,005 bp of chicken FTO
Supplementary Table 4Association of M2, and M4 to M15, with chicken growth, body composition and fatness traits
Supplementary Figure 1 Phylogenetic tree of 22 species, based on FTO precursor sequences.This tree was constructed using the UPGMA method ofthe MEGA 4.0.1 program using 1000 bootstrap replications.Numbers above or belowbranches indicate the bootstrap values (percentage of 1000 replicates). Number scale in the lower left indicates genetic distance. I to VI representsix distinct phylogenetic groups.
Supplementary Figure 2LD structure among 18 SNPs in the FTO region. Location of each SNP is indicated at the top of the diagram.LD is presented as a 2×2 matrix in which red represents very high LD (r2)and white indicates absence of correlation between SNPs. The r2values were calculated with Haploview 3.2. Three SNPs (M4, M15 and M17) that did not follow Hardy-Weinberg equilibrium were excluded from LD analysis.
SupplementaryTable 1Primers used in this study
Name / Forward (5’-3’) / Reverse (5’-3’) / Annealing Temp (°C)P-M / tccaagctaattttcagaaagt / attttgtagatgaacaattac / 56
P-Race1 / aatggagcttatgacgagcct / aagcagtggtaacaacgcagagt / 60
P-Race2 / aagcagtggtaacaacgcagagt / ccctcagtaggccaaggaact / 62
P-Race2N / aagcagtggtaacaacgcagagt / taagtgcatcctggctttcca / 60
FTO-Q1 / gaacatggcagtgagttggcatc / ggtggagctgaaccgaggtgaa / 61
P-actin / ctcccccatgccatcctccgtctg / gctgtggccatctcctgctc / 60
P1 / gtcctacaaggttggctttactcg / tgctacagggactcggaaatga / 59
P2 / ttcattcatacgcccacttc / catgtcaaatcctagaccct / 56
P3 / aatgccttgttgttcttgttt / ttggaagtactagaagtcaactgaa / 60
P4 / ttaattactagaactacaagcaaag / atctgagcaaattctacttatgt / 61
P5 / aatggagcttatgacgagcct / atgaggcatggcatagcacat / 60
P6 / tgaaaacaaaagcagcagaat / tttcatggcaatagaagtatc / 58
P7 / gtctggttggtaaactaggggaaac / gcccatcacctcctgacactg / 60
P8 / ggaggcacaatacaaacagga / agcattccacctcacaaagga / 58
P9 / atacattggaaaccggcaaac / gactcaggaacgaaggtggaa / 59
P10 / gctttcactttcaatttcat / catcctcctccacatccttt / 58
P11 / gccagtcagaagcagcggagag / actgtgcacctcttgggctgaac / 61
PGC1α-Q / gactcaggtgtcaatggaagtg / atcagaacaagccctgtggt / 61
STAT3-Q / ggaggcatttgggaagta / atgggcaggtcaatggta / 60
PPARα-Q / acggagttccaatcgc / aacccttacaaccttcacaa / 60
AMPK-Q / gcactgcccatccctctaa / cggctgccacgaaacaa / 60
IGF1R-Q / gtacttcagtgcttcggatgtg / cttcttcagagttggaggtgct / 60
GHSR-Q / tgggcgtcgagcatgaga / acagcaccgtgaggcaga / 60
Leptin-R-Q / taccgtgcctactgctga / aactggcgttgttattgc / 60
HL-Q / ttggcttacatttgctcacc / gctcctaggctgtacccaatta / 60
SupplementaryTable 2cDNA database sequences used for phylogenetic analysis
No. / Species / Protein ID21 / Gallus gallus1 / NP_001172076
2 / Anas platyrhynchos1 / ADH51649.1
3 / Anser anser1 / ADH51652.1
4 / Homo sapiens / NP_001073901.1
5 / Macaca mulatta / XP_001092038.1
6 / Pan troglodytes / XP_510968.2
7 / Oryctolagus cuniculus / ACJ53748.1
8 / Equus caballus / XP_001492838.2
9 / Bos Taurus / NP_001091611.1
10 / Ovis aries / NP_001098401.1
11 / Rattus norvegicus / NP_001034802.1
12 / Sus scrofa / NP_001106162.1
13 / Mus musculus / NP_036066.2
14 / Monodelphis domestica / XP_001372283.1
15 / Ornithorhynchus anatinus / XP_001520255
16 / Xenopus laevis / NP_001087481.1
17 / Danio rerio / AAH92844.1
18 / Saccoglossus kowalevskii / XP_002738337.1
19 / Micromonas sp. / ACO64022.1
20 / Micromonas pusilla / ABY26524.1
21 / Ostreococcus tauri / XP_003082290.1
22 / Ostreococcus lucimarinus / XP_001420808.1
1Sequences generated in the current study. 2 NCBI accession numbers for FTO peptides of each species.
Supplementary Table 3 Genetic variations identified in 8,005 bp of chicken FTO
Name / SNPs1 / Location / Note2M1 / G4938404T / 5’flanking / Sequencing
M2 / C4938390T / 5’flanking / Sequencing
M3 / C4938374T / 5’flanking / Sequencing
M4 / A4938324G / 5’flanking / Sequencing
M5 / T4938170A / 5’flanking / Sequencing
M6 / A4938150C / 5’flanking / Sequencing
M7 / G4938090A / 5’UTR / Sequencing
M8 / G4938082A / 5’UTR / Sequencing
M9 / C4937926T / intron1 / Sequencing
M10 / T4937918C / intron1 / Sequencing
M11 / C4937901T / intron1 / Sequencing
M12 / G4910140A / intron1 / RFLP (BclI)
M13 / G4854795A / intron5 / RFLP (TaqI)
M14 / C4848865G / intron6 / RFLP (Bstz17I)
M15 / T4848695G / intron6 / RFLP (PmlI)
M16 / G4677213A / exon9 / Ala467Val; RFLP (BbvI)
M17 / A4675075G / 3’UTR / RFLP (TaiI)
M18 / T4674902G / 3’UTR / RFLP (Csp6I)
M19 / GC4938293/-- / 5’flanking
M20 / G4938095- / 5’flanking
M21 / T4886652A / exon3 / Leu158Ile
M22 / G4886441A / exon3 / Gly228Glu
M23 / A4910324G / intron1
M24 / G4910130A / intron1
M25 / G4910120A / intron1
M26 / G4910112T / intron1
M27 / C4910085T / intron1
M28 / A4886281G / intron3
M29 / G4879926C / intron3
M30 / G4879857T / intron3
M31 / C4879769T / intron3
M32 / T4879757C / intron3
M33 / C4879747T / exon4 / Ser258Leu
M34 / G4879729C / exon4 / Thr264Ser
M35 / C4856349T / intron4
M36 / G4856346A / intron4
M37 / A4856092G / intron5
M38 / G4856080A / intron5
M39 / G4856031A / intron5
M40 / T4855970C / intron5
M41 / A4854827G / intron5
M42 / A4854823C / intron5
M43 / G4854790T / intron5
M44 / G4854688A / intron5
M45 / C4854674A / intron5
M46 / G4854656A / intron5
M47 / T4854641A / intron5
M48 / G4854628C / intron5
M49 / A4854598G / intron5
M50 / G4848431A / intron7
M51 / A4848417G / intron7
M52 / T4677457C / intron8
M53 / G4677441C / intron8
M54 / C4677400G / intron8
M55 / C4677368T / intron8
M56 / C4677049T / exon9 / Synonymous
M57 / C4677027T / exon9 / Synonymous
M58 / C4675250T / 3’UTR
M59 / C4675228T / 3’UTR
M60 / G4675138A / 3’UTR
M61 / A4675098G / 3’UTR
M62 / T4675093C / 3’UTR
M63 / G4675010A / 3’UTR
M64 / T4674975G / 3’UTR
M65 / 4675072T / 3’UTR
M66 / GTAGAC/- / 3’UTR
M67 / G4674913T / 3’UTR
1 The location of each SNP is designated according to the Chicken Blat search released in May 2006 ( 2 M1 to M11 were genotyped by sequencing and further used for association analysis. M12 to M18 were genotyped by PCR-RFLP and further used for association analysis; the restriction enzyme for each SNP is indicated in brackets. M21 and M22, and M33 and M34 are non-synonymous SNPs causingthe indicated amino acid changes, whereas M56 and M57 are synonymous SNPs.
1
1
Supplementary Table 4Association of M2, and M4 to M15, with chicken growth, body composition and fatness traits (P values and LSM±SEM)
SNPs / Traits / P value / Least squares mean ± Standard errorM2 / LMF (%) / 0.024 / 64.23 ± 0.53a (395) / CC / 59.23 ± 2.19b (31) / CT / (0)/ TT
M2 / CSALMF (μm2) / 0.045 / 19675 ± 307.6a (170) / CC / 17491 ± 1091b (17) / CT / (0)/ TT
M4 / LMCPC (%) / 0.001 / 20.76 ± 0.07aA (168) / AA / 20.06 ± 0.16bB (24) / AG / 20.6 ± 0.22aAB (13) / GG
M4 / BMCFC (%) / 0.013 / 1.04 ± 0.03A (168) / AA / 1.05 ± 0.08A (24) / AG / 0.71 ± 0.11B (13) / GG
M5 / WLR (%) / 0.009 / 27.66 ± 2.46aA (19) / AA / 20.72 ± 1.47bAB (38) AT / 17.29 ± 2.1bB (19) / TT
M6 / WLR (%) / 0.024 / 24.27 ± 1.67aA (38) / AA / 19.11 ± 2.03abAB (26) / AC / 14.28 ± 2.9bB (12) / CC
M7 / BW7 (g) / 0.017 / 58.93 ± 0.43ab (322) / AA / 61.93 ± 1.31ac (40) / AG / 63.66 ± 2.47a (7) / GG
M7 / BW14 (g) / 0.010 / 122.1 ± 0.90b (351) / AA / 128.0 ± 2.66a (48) / AG / 134.2 ± 5.33a (7) / GG
M7 / BMCPC (%) / 0.040 / 24.84 ± 0.08a (167) / AA / 24.94 ± 0.24a (23) / AG / 25.95 ± 0.44b (4) / GG
M8 / SL63 (mm) / 0.016 / 80.29 ± 1.43A (29) / AA / 75.35 ± 1.08B (73) / AG / 77.14 ± 1.39AB (38) / GG
M8 / WLR (%) / 0.043 / 16.2 ± 2.26b (17) / AA / 20.55 ± 1.63ab (33) / AG / 25.40 ± 2.42a (25) / GG
M9 / HW (mm) / 0.035 / 30.1 ± 0.12b (189) / CC / 30.53 ± 30.53a (155) / CT / 30.19 ± 0.18ab (69) / TT
M9 / WLR (%) / 0.018 / 24.32 ± 1.74aA (36) / CC / 18.58 ± 1.96bAB (26) / CT / 14.00 ± 2.73bB (13) / TT
M10 / WLR (%) / 0.044 / 16.03 ± 2.46b (18) / CC / 20.56 ± 1.41ab (36) / CT / 25.03 ± 2.25a (25) / TT
M11 / HW (mm) / 0.027 / 66.3 ± 0.45bB (172) / CC / 67.62 ± 0.49aA (159) / CT / 66.31 ± 0.69abAB (69) / TT
M11 / WLR (%) / 0.010 / 24.62 ± 1.69aA (35) / CC / 18.55 ± 1.84bAB (27) / CT / 14.09 ± 2.66bB (14) / TT
M12 / BW14 (g) / 0.031 / 125.2 ± 1.33A (197) / AA / 121.0 ± 1.16B (208) / AG / 121.0 ± 1.95AB (75) / GG
M12 / BW28 (g) / 0.028 / 313.8 ± 4.07A (195) / AA / 301.0 ± 3.56B (207) / AG / 306.2 ± 6.04AB (72) / GG
M12 / ADG0-4 (g/d) / 0.028 / 10.14 ± 0.15A (195) / AA / 9.68 ± 0.13B (207) / AG / 9.87 ± 0.22AB (72) / GG
M13 / DW (g) / 0.008 / 1374.68 ± 15.42aA (117) / AA / 1321.45 ± 9.84abAB (216) / GA / 1345.39 ± 14.54bB (139) / GG
M14 / WW (g) / 0.033 / 62.89 ± 0.92b (70) / GG / 65.31 ± 0.52a (199) / GC / 65.74 ± 0.58a (205) / CC
M14 / SL42 (mm) / 0.031 / 61.68 ± 0.64a (67) / GG / 60.67 ± 0.35ab (194) / GC / 59.7 ± 0.39b (203) / CC
M14 / SL56 (mm) / 0.009 / 73.31 ± 0.7aA (69) / GG / 72.33 ± 0.39aAB (196) / GC / 70.93 ± 0.43bB (203) CC
M14 / LMSS (%) / 0.027 / 65.42 ± 3.95b (70) / GG / 75.27 ± 2.22a (200) / GC / 69.35 ± 2.49ab (205) / CC
M15 / HW (mm) / 0.028 / 29.87 ± 0.21a (46) / GG / 30.37 ± 0.1b (275) / GT / 30.09 ± 0.14ab (156) / TT
BW7, BW14, BW28 = body weight at 7, 14, 28 days of age, respectively; ADG0-4 = average daily gain from0 to 4 weeks; LMF = leg muscle flesh color; CSALMF = cross sectional area in leg muscle fiber; LMCPC = crude protein content of leg muscle; BMCPC = crude fat content of breast muscle; SL42, SL56, SL63 = shank length at 42, 56, 63 days, respectively; WLR = water loss ratio of breast muscle; HW = head width; DW = dressed weight; WW = wing weight; LMSS = leg muscle shear stress. Statistical analysis was performed using GLM by SAS8.0, and data are shown as least square mean±S. E. M. Means not sharing a superscript capital letter in the same column were highly significantly different (P < 0.01), and those not sharing a small letter were significantly different(P < 0.05). Numbers in brackets indicate the number of birds in thatSNP genotype group. The SNP genotype is indicated after the sample size.
1