Arabidopsis Acyl-Coa-Binding Protein ACBP6 Localizes in the Phloem and Affects

Arabidopsis acyl-CoA-binding protein ACBP6 localizes in the phloem and affects jasmonatecomposition

Zi-Wei Ye, Shiu-Cheung Lung, Tai-Hua Hu, Qin-Fang Chen, Yung-Lee Suen, Mingfu Wang, Susanne Hoffmann-Benning, Edward Yeung andMee-Len Chye

Supplementary data

Figure S1.Specificity of anti-AtACBP6 specific antibodies.

Figure S2. Controls for immunogold localization of AtACBP6 in Arabidopsis stem in transmission electron microscopy.

Figure S3. Mass spectrum analysis of the compound peaks at the retention time of 24.6 min, 31.9 min and 36.6 min in Col-0 and acbp6 fatty acid profiles.

Figure S4.GC-MS for untransmethylated Col-0 phloem exudates and the standards in the GC-MS analysis

Figure S5.Isothermal titration calorimetry profiles of recombinant AtACBP6 with 18:3-CoA, JA and OPDA.

Table S1. Major compounds identified in the phloem exudates from GC-MS analysis.

Table S2.Oligonucleotide primers used in this study.

Supplementary methods

Testing the specificity of anti-AtACBP6 specific antibodies

(His)6-AtACBP6 protein was purified according to Hsiao et al (2014). The western blot analysis was carried out using anti-AtACBP6 antibodies first reported by Chen et al. (2008).Protein concentration was determined by the Bradford (1976) assay.Recombinant AtACBP6, BSAand AtACBP6-overexpressor were loaded on the 15% SDS-PAGE gels, followed by blotting to Hybond-C membrane (Amersham) with the Trans-Blot Cell (BioRad). The blots were incubated with rabbit polyclonal antibodies raised against a synthetic peptide (VEGKSSEEAMNDY) corresponding to amino acids 63-75 of AtACBP6 (Chen et al. 2008). Different concentrations (1:500 to 1:20000) of anti-AtACBP6 specific antibodies were used in western blot analysis to analyze the optimal concentration of AtACBP6 in the subsequent western blot analysis.Detection of immunoreactive signals was carried out using the Amplified Alkaline Phosphatase Goat-Anti-Rabbit Assay Kit (BioRad) according to the manufacturer’s instructions.

Isothermal titration calorimetry (ITC)

Isothermal titration calorimetry experiments were carried out using a MicroCal iTC200system (GE Healthcare, Piscataway, NJ, USA). Final concentrations of 20μM (His)6-AtACBP6, 0.5 mM JA and 0.5 mMcis-OPDA (Larodan, Malmo, Sweden) and 250 μMlinolenoyl-CoA (18:3-CoA) (Avanti Polar Lipids, Alabaster, AL, USA) were used for these binding tests. (His)6-AtACBP6 was titrated with 1.8μl of 0.5 mMMeJA and 0.5 mMcis-OPDA and 250 μM 18:3-CoA with a duration of 3.6 s and a 150s interval between injections at 30°C. Twenty injections were carried out in each experiment. The 18:3-CoA is a positive control according to Hsiao et al (2014). Raw data were integrated and analyzed using the ORIGIN7 software (OriginLab, Northampton, MA, USA) supplied with theinstrument.

Supplementary data

Fig. S1Specificity of anti-AtACBP6 specific antibodies.

(a) The position of the antigenic peptide (red) in AtACBP6 with respect to the alignment of other members in the AtACBP family. The rabbit polyclonal anti-AtACBP6 specific antibodies were raised against a synthetic peptide (VEGKSSEEAMNDY) corresponding to amino acids 63-75 of AtACBP6 (Chen et al. 2008) as indicated in red. (b) Optimization of different concentrations of anti-AtACBP6 specific antibodies in western blot analysis of recombinant AtACBP6, BSA and AtACBP6-overexpressor.

Supplementary data

Fig. S2Controls for immunogold localization of AtACBP6in Arabidopsis stem in transmission electron microscopy.

(a) Cross section of the apical stem from 5-week-old Arabidopsisstained with the anti-AtACBP6 antibodies. (b)-(c) show the xylem cells magnified from (a) stained with AtACBP6-specific antibodies;(d)-(f) show the epidermal cells stained with anti-AtACBP6 antibodies; (f) shows the replacement of rabbit anti-AtACBP6 antibodies with pre-immune rabbit serum; (g) shows the phloem area stained only with secondary antibodies. CC, companion cell; SE, sieve element; X, xylem; e, epidermal cell.

Supplementary data

Fig. S3Mass spectrum analysis of the compound peaks at the retention time of 24.6 min, 31.9 min and 36.6 min in Col-0 and acbp6 fatty acid profiles.

(a) Mass spectrum of compounds from Col-0 at retention time 24.6 min.

(b) Mass spectrum of compounds from acbp6 at retention time 31.9 min.

Supplementary data

Fig. S4GC-MS for untransmethylated Col-0 phloem exudates and the standards in the GC-MS analysis

(a) Gas chromatogram of hexane phase of the untransmethylated Col-0 Arabidopsis phloem exudate. Deuterium-labeled MeJA was used as an internal standard.

(b) Mass spectrum of the deuterium-labeled MeJA standard (24.6 min).

(d) Mass spectrum of the cis-OPDA standard (31.9 min).

Supplementary data

Fig. S5Isothermal titration calorimetry profiles of recombinant AtACBP6 with 18:3-CoA, JA and cis-OPDA.

Thermograms are shown for the interaction of between rAtACBP6 with 18:3-CoA (a), JA (b) and cis-OPDA (c). The interaction between rAtACBP6 with 18:3-CoA serves as the positive control (Hsiao et al. 2014), while rAtACBP6 showed no bindings to JA and cis-OPDA. Upperpanel, raw heat signal from 20 injections of 1.8-μl aliquots of 18:3-CoA, JA and cis-OPDA into a cell containing 20 μM rAtACBP6 at 30˚C. Lower panel, the integrated area (heat) of each injection after background correction.

Supplementary Table S1. Major compounds identified in the phloem exudates from GC-MS analysis.

Retention time (min) / Compound
7.1 / But-2-enedioic acid
12.8 / Benzaldehyde
15.3 / 3,5-dimethylbenzoate
17.5 / Tetradecanoic acid (C14:0)
22.3 / Palmitic acid (C16:0)
24.4 / Phenol, bis
24.6 / Jasmonate (and/or its derivatives)*
26.7 / Octadecanoicacid (C18:0)
26.7 / Oleic acid (C18:1)
28.1 / linoleicacid(C18:2)
28.8 / Nonadecanoic acid (C19:0; internal standard)
29.4 / Linolenicacid (C18:3)
30.8 / Eicosanoic acid (C20:0)
31.9 / 12-oxo-cis,cis-10,15-phytodienoic acid
36.6 / dinor-oxo- phytodienoic acid

* The FAMEDB library identified the compound at retention time of 24.6 min as methyl jasmonate, while it may originally come from the jasmonate acid and/or its derivatives.

Supplementary Table S2.Oligonucleotide primers used in this study.

Gene name / Gene / Orientation / Sequence (5’ – 3’) / Reference
PCC1 / At3g22231 / Forward / TCCTCACTCCTCAGCTCCTC / Guelette et al.2012
PCC1 / At3g22231 / Reverse / GTTTGGGCAACGACTTCTGT / Guelette et al.2012
UBC9 / At4g27960 / Forward / TGGCTTCGAAAAGGATCTTG / Guelette et al.2012
UBC9 / At4g27960 / Reverse / TCGATATGGTGAGTGCAGGA / Guelette et al.2012
ACBP6 / At1g31812 / Forward / TGTCCTCGTCTTCTCCG / Hisao et al. 2015
ACBP6 / At1g31812 / Reverse / CAGCGTGCTCCTCAAA / Hisao et al. 2015
ANTIN2 / At3g18780 / Forward / CCCGCTATGTATGTCGC / Du et al. 2013
ANTIN2 / At3g18780 / Reverse / AAGGTCAAGACGGAGGAT / Du et al. 2013
AOS / At5g42650 / Forward / CGAAACCGGATCTTCCCTGA / Sasaki-Sekimoto et al. 2013
AOS / At5g42650 / Reverse / GCGTCGGCTTTGAGCTTTGT / Sasaki-Sekimoto et al. 2013
AOC / At3g25770 / Forward / TTCAGCAGTGTCTCTCCAATCCA / Sasaki-Sekimoto et al. 2013
AOC / At3g25770 / Reverse / GCAGTGAGGTTCTTCTTGGCAGT / Sasaki-Sekimoto et al. 2013
CTS / At4g39850 / Forward / ATCCGCTTCGGTATCCGTGT / This study
CTS / At4g39850 / Reverse / CGGAGCATTGTCAGCATATACTGG / This study
OPR3 / At2g06050 / Forward / GGAAAACAGGTGGCGAGTTT / This study
OPR3 / At2g06050 / Reverse / GAAACCAGCTCGAATCGCAT / This study
OPCL / At1g20510 / Forward / GCTCCAG CTGAGCTAGA GGCTTT / This study
OPCL / At1g20510 / Reverse / CTTGCCTGAAGGGTTCTTTGGT / This study
ACX / At4g16760 / Forward / TGCTTCGTCCTTCTTCTTCG / Dave et al. 2011
ACX / At4g16760 / Reverse / TTAATGTTGCATTGAAAACGAAA / Dave et al. 2011

References for Supplemental data

Dave A, Hernandez ML, He Z, Andriotis VME, Vaistij FE, Larson TR, Graham IA (2011)12-oxo-phytodienoic acid accumulation during seed development represses seed germination in Arabidopsis. Plant Cell 23: 583-599.

Du ZY, Chen MX, Chen QF, Xiao S, Chye ML (2013) Overexpression of Arabidopsis acyl-CoA-binding protein ACBP2 enhances drought tolerance. Plant Cell Environ 36: 300-314.

Guelette BS, Benning UF, Hoffmann-Benning S (2012) Identification of lipids and lipid-binding proteins in phloem exudates from Arabidopsis thaliana. J Exp Bot 63: 3603-3616.

Hsiao AS, Haslam RP, Michaelson LV, Liao P, Chen QF, Sooriyaarachchi S, et al. (2014) Arabidopsis cytosolic acyl-CoA-binding proteins ACBP4, ACBP5 and ACBP6 have overlapping but distinct roles in seed development. Biosci Rep 34: 865-877.

Hsiao AS, Yeung EC, Ye ZW, Chye ML (2015) The Arabidopsis cytosolic acyl-CoA-binding proteins play combinatory roles in pollen development. Plant Cell Physiol 56: 322-333.

Sasaki-Sekimoto Y, Jikumaru Y, Obayashi T, Saito H, Masuda S, Kamiya Y, et al.(2013) Basic helix-loop-helix transcription factors JASMONATE-ASSOCIATED MYC2-LIKE1 (JAM1), JAM2, and JAM3 are negative regulators of jasmonate responses in Arabidopsis. Plant Physiol163: 291-304.