Supplement 1. The sequences of anti-miRNAs oligos
ASO / Sequence (5’→3')Aso-miR-16(Anti-16) / cgccaauauuuacgugcugcua
Aso-miR-17-5p(Anti-17) / cuaccugcacuguaagcacuuug
Aso-miR-20(Anti-20) / cuaccugcacuauaagcacuuua
Aso-miR-34a(Anti-34a) / aacaaccagcuaagacacugcca
Aso-miR-34b(Anti-34b) / auggcaguggaguuagugauug
Aso-miR-34c(Anti-34c) / agcaaucagcuaacuacacugccu
Aso-miR-106(Anti-106) / cuaccugcacuguaagcacuuuu
Aso-miR-125(Anti-125) / ucacagguuaaagggucucaggga
Aso-miR-150(Anti-150) / cacugguacaaggguugggaga
Supplement 2. Forward primers used to amply different miRNAs
Primers / Sequences of forward Primers and Tm valuemiR-16
miR-17-5p
miR-20
miR-34a
miR-34b
miR-34c
miR-106
miR-125
miR-150
5sRNA / 5’- tagcagcacataaatattggcg-3’ Tm (53°C)
5’- caaagtgcttacagtgcaggtag-3’ Tm (51°C)
5’- aagtgcttatagtgcaggtag-3’ Tm (53°C)
5’- tggcagtgtcttagctggtt-3’ Tm (53°C)
5’- caatcactaactccactgccat-3’ Tm (53°C)
5’-aggcagtgtagttagctgat-3’ Tm (53°C)
5’- aaaagtgcttacagtgcaggtag-3’ Tm (51°C)
5’-tccctgagaccctttaacct-3’ Tm (51°C)
5’-tcccaacccttgtaccagt-3’ Tm (53°C)
5’- gccataccaccctgaacg-3’ Tm(53°C)
Supplement 3. PCR primers used to amply miRNA targeting genes
Primers / Sequences of the Primers and Tm valueBCL2-1-2
P53-1-2
E2F1-1-2
E2F3-1-2
Rb-1-2
β-Actin-1-2 / BCL2-1:5’-ttgccacggtggtggagga-3’;
BCL2-2:5’- acagccaggagaaatcaaacag-3’; Tm(53°C), 258 bp.
P53-1:5’-atggaggagccgcagtca-3’;
P53-2:5’- atgcaagaagcccagacg -3’; Tm(53°C), 345 bp.
E2F1-:5’-ttgccaagaagtccaagaac-3’;
E2F1-2: 5’- tgtggtgagggatgaggg-3’; Tm(55°C), 494 bp.
E2F3-1:5’-ttgaacaaggcagcagaa-3’;
E2F3-2: 5’- cagtttgaggtccagggt-3’; Tm(53°C), 249 bp.
Rb1: 5’-aaccctcctaaaccactg-3’;
Rb2: 5’- gggccattcttactatcc-3’; Tm(53°C), 490 bp.
β-Actin1:5’-ctacaatgagctgcgtgtggc-3’;
β-Actin2: 5’- caggtccagacgcaggatggc-3’; Tm(55°C), 270 bp.
Supplement 4. Inhibition of miR-16 with different concentration of ASOs
After 2×105 A549 cells were treated with 5μM, 10μM, 20 μM and 30μM special to miR-16 for 72h, the expression of miRNAs was detected by Real-time PCR. The effective concentration to inhibit miRNAs expression was found to be 20 μM.
Supplement 5. Regulation HBE and 293Tcells growth with ASO
(A) The number of alive cells of HBE was analyzed by microscopy after ASO treatment (400×). The number of HBE cells growth was lesser in ASO-20, ASO-106 or ASO-150 group than that of other ASO (ASO-16, ASO-17, ASO-125 or ASO-34A-C) or control group.
(B) Annexin V-FITC Kit detection of HBE cells by fluorescence microscopy (400×). Green, a fluorescent probe (Annexin V-FITC) binded to phosphatidylserine exposure; Red, PI staining used to detect the apoptotic DNA fragments. The Annexin V-FITC detection showed that more apoptosis cells (red or green) were found in ASO-20, ASO-106 or ASO-150 group that of other ASO (ASO-16, ASO-17, ASO-125 or ASO-34A-C) or control group.
(C) Alive 293T cells were analyzed by microscopy after ASO treatment (400×). The number of cells growth was lesser in ASO-20, ASO-106 or ASO-150 group than that of other ASO or control group.
(D) Annexin V-FITC Kit detection of 293T cells. The results showed that more apoptosis cells (red or green) were found in ASO-20, ASO-106 or ASO-150 group.