Bacterial and Archaeal Communities in Sediments of the North Chinese Marginal Seas

Bacterial and archaeal communities in sediments of the north Chinese marginal seas

Submitted to Microbial Ecology

Authors: Jiwen Liu, Xiaoshou Liu, Min Wang, Yanlu Qiao, Yanfen Zheng, Xiao-Hua Zhang*

Affiliation: College of Marine Life Sciences, Ocean University of China, Qingdao 266003, China

*Author for correspondence:

Xiao-Hua Zhang, College of Marine Life Sciences, Ocean University of China, 5 Yushan Road, Qingdao 266003, China; Email:

Materials and Methods

Nucleic acid extraction, PCR amplification, 454 pyrosequencing and data analysis

Total DNA was extracted from 1 g (wet weight) of sediments using an EZNA Soil DNA Kit (Omega Bio-Tek Inc., Norcross, GA, USA) according to the manufacturer’s instruction and the quality and quantity of total DNA were verified with 1% gel electrophoresis and Gene Quant 100 (GE, USA). The DNA quantity of samples ranged from 9-23 ng/μl with ratio of A260/280>1.7.

Both bacterial and archaeal 16S rRNA genes were amplified from the community DNAs using barcoded primers 8F (5’-AGAGAGTTTGATCCTGGCTCAG-3’), 533R (5’-TTACCGCGGCTGCTGGCAC-3’) for bacteria and 344F (5’-ACGGGGYGCAGCAGGCGCGA-3’), 915R (5’-GTGCTCCCCCGCCAATTCCT-3’) for archaea. The barcodes for each samples were listed below: NECS1, ATCTGAGACG; NECS2, ATGCTACGTC; NECS3, ATGTGACTAC; SYS1, ATACTAGCAC; SYS2, ATAGAGCTAG; SYS3, ATACGCGTGC; NYS1, ATACGCGTGC; NYS2, AGTCTGTCTG; NYS3, ATACACACGA; BS1, AGCTAGATAC; BS2, AGCTGTCGAC; BS3, AGCGTGTGCG . Barcodes sequences were ligated to sequencing primers during the process of synthesizing, before PCR was performed.

A 20 μl PCR reaction was performed in triplicate at the following condition: initial denaturation at 95°C for 2 min, 25 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s, and then a final extension of 72°C for 5 min. The polymerase used was 2.5 units/µl with a amplification level of 2-4 kb/min. The template DNA used in the PCR reaction ranged from 9-23 ng per 20μl reaction system. Negative control was performed during amplification. The replicated tagged PCR products of each sample were purified using an AxyPrepDNA Gel Extraction Kit (Axygen, Hangzhou, China) and quantified using a Quant-iT PicoGreen double-stranded DNA assay (Invitrogen, Carlsbad, CA). The concentration of PCR products were 2.62-8.20 ng/μl. The amplicons from each reaction mixture were pooled in equimolar ratios based on concentration and subjected to emulsion PCR to generate amplicon libraries.

All reads not matching the barcodes and primers sequences were excluded. Reads were then trimmed by removing the sequencing adaptor, barcodes and primers sequences. Reads shorter than 200 base pairs, with average quality score lower than 25 and with any ambiguous bases were further removed. Chimeras were detected and removed by UCHIME Ref [1], and reads that did not align with the prokaryotic 16S rRNA gene region like chloroplast were excluded from further analysis. The selected sequences were clustered into operational taxonomic units (OTUs) at 97% dissimilarity level with the furthest neighbor algorithm and taxonomy was assigned against the SILVA v111 database (http://www.arb-silva.de) with 80% similarity threshold. All analyses were done using Mothur.

Quantitative PCR (qPCR)

All assays were conducted in triplicate using ABI Prism 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Thermocycling of 16S rRNA genes consisted of an initial denaturation at 95°C for 15 min, followed by 40 cycles of 95°C for 1min and annealing temperature for 30s, and 72°C for 40 s. Thermocycling of dsrB consisted of an initial denaturation at 95°C for 3 min, followed by 35 cycles of 95°C for 45 s, 55°C for 1 min and 72°C for 1 min.

Each 20 μl real-time PCR reaction contained the following components: 10 μl of SYBR Green Realtime PCR Master Mix (TaKaRa, Tokyo, Japan), 1 μl of each primer (10 mM), 6 μl of H2O and 2 μl of template. The plasmid concentration was determined using Gene Quant 100 (GE, USA) and the formula to calculate copies numbers was shown below:

copies numbers (copies/µL) = 6 1014

The template DNA used in the real-time PCR reaction was 100, 16 and four-fold diluted for Bacteria, Archaea and sulfate-reducing prokaryotes, respectively. Primer sets Eub338/518 (Eub338F: ACTCCTACGGGAGGCAGCAG, Eub518R: ATTACCGCGGCTGCTGG) and Arch16F/344R (Arch16F: 5’-CTGGTTGATCCTGCCAG, Arch344R: TTCGCGCCTGSTGCRCCCCG) with an annealing temperature of 53°C and 61°C were used for Bacteria and Archaea, respectively. Primer set DSRp2060F/DSR4R (DSRp2060F: CAACATCGTYCAYACCCAGGG, DSR4R: GTGTAGCAGTTACCGCA) with an annealing temperature of 55°C was used for sulfate-reducing prokaryotes.

Figures and Tables

Table S1. Relative abundance of the top bacterial classes and orders in each samples as shown by percentage (%).

Table S2. Relative abundance of the top archaeal clades in each sampling area as shown by percentage (%).

Table S3. Pearson Correlation of bacterial and archaeal community at OTU level with geographic distance and environmental factors as determined by Mantel and partial Mantel test with 999 permutations (r, Mantel statistics; P, significance). Geographic distance was calculated from longitude and latitude in R.

Fig. S1. The rarefaction curves plotted by OTUs as a functional of original reads of the samples.

Fig. S2. Relative abundance of Delatproteobacteria and Gammaproteobacteria of surface sediments from the open sea to coastal sea areas at a global scale. Data were obtained from different literatures: Guinea Basin I-South Atlantic Ocean, Angola Basin-South Atlantic Ocean and Cape Basin-South Atlantic Ocean [2]; Northeastern Pacific Ocean [3]; Antarctic Continental Shelf Sediment [4]; An Arctic Fjord of Svalbard [5]; Northern slope of the South China Sea [6]; Cobalt-rich crust deposit region in the Pacific Ocean [7]; Deep-Sea Carbonate Crusts eastern Mediterranean [8]; Pacific Arctic Ocean [9]; Southern Cretan margin, Eastern Mediterranean Sea [10]; Sørfjord in southern Norway [11]; Florida Coastal [12]; Yamada bays in Japan [13]; Polluted Baltic Sea sediments [14]; Bizerte Lagoon (Tunisia), Southern Mediterranean Coastal [15]; Victoria harbor at the Pearl River estuary [16]; Bohai Sea, Yellow Sea and North of East China Sea, this study.

Fig. S3. RDA analysis illustrating the relationship between the microbial community structure from different sampling sites and environmental variables. A. Bacterial community at class level; B. Archaeal community mainly at class and order levels.

Reference

1. Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27: 2194-2200. doi: 10.1093/bioinformatics/btr381

2. Schauer R, Bienhold C, Ramette A, Harder J (2010) Bacterial diversity and biogeography in deep-sea surface sediments of the South Atlantic Ocean. ISME J 4: 159-170. doi: 10.1038/ismej.2009.106

3. Hongxiang X, Min W, Xiaogu W, Junyi Y, Chunsheng W (2008) Bacterial diversity in deep-sea sediment from northeastern Pacific Ocean. Acta Ecol Sinica 28: 479-485. doi: 10.1016/S1872-2032(08)60026-8

4. Bowman JP, McCuaig RD (2003) Biodiversity, community structural shifts, and biogeography of prokaryotes within Antarctic continental shelf sediment. Appl Environ Microbiol 69: 2463-2483. doi: 10.1128/AEM.69.5.2463-2483.2003

5. Teske A, Durbin A, Ziervogel K, Cox C, Arnosti C (2011) Microbial community composition and function in permanently cold seawater and sediments from an Arctic fjord of Svalbard. Appl Environ Microbiol 77: 2008-2018. doi: 10.1128/AEM.01507-10

6. Liao L, Xu X-w, Wang C-s, Zhang D-s, Wu M (2009) Bacterial and archaeal communities in the surface sediment from the northern slope of the South China Sea. J Zhejiang Univ Sci B 10: 890-901. doi: 10.1631/jzus.B0920181

7. Liao L, Xu XW, Jiang XW, Wang CS, Zhang DS, Ni JY, Wu M (2011) Microbial diversity in deep‐sea sediment from the cobalt‐rich crust deposit region in the Pacific Ocean. FEMS Microbiol Ecol 78: 565-585. doi: 10.1111/j.1574-6941.2011.01186.x

8. Heijs S, Aloisi G, Bouloubassi I, Pancost R, Pierre C, Damsté JS, Gottschal J, Van Elsas J, Forney L (2006) Microbial community structure in three deep-sea carbonate crusts. Microb Ecol 52: 451-462. doi: 10.1007/s00248-006-9099-8

9. Li H, Yu Y, Luo W, Zeng Y, Chen B (2009) Bacterial diversity in surface sediments from the Pacific Arctic Ocean. Extremophiles 13: 233-246. doi: 10.1007/s00792-009-0225-7

10. Polymenakou PN, Lampadariou N, Mandalakis M, Tselepides A (2009) Phylogenetic diversity of sediment bacteria from the southern Cretan margin, Eastern Mediterranean Sea. Syst Appl Microbiol 32: 17-26. doi: 10.1016/j.syapm.2008.09.006