Article title: Transcript profiling of aquaporins during basidiocarp development in Laccaria bicolor ectomycorrhizal with Picea glauca

Journal name: Mycorrhiza

Authors: Hao Xu, Alfonso Navarro-Ródenas, Janice EK Cooke, Janusz J Zwiazek

Author for Correspondence: Janusz J Zwiazek

Department of Renewable Resources, University of Alberta, Edmonton, Canada, T6G 2E3

E-mail:

Supplementary material:

Table S1 Characteristics of the six aquaporins of Laccaria bicolor UAMH8232

Table S1 Characteristics of the six aquaporins of Laccaria bicolor UAMH8232

Aquaporin1 / Protein ID1 / Length of deduced polypeptide / TMHs2 / NPA motifs / ar/R / Subcellular localization3 / Phylogenetic cluster4 / Pf
(μm s-1)5 / CO2 transport capacity6 / Primers for qRT-PCR7 / Corresponding aquaporins in strain S238N and their transport capacity8
JQ585592 / AFJ15555 / 311 / 6 / NPN, NSA / F H A R / Secretory
RC 5 / I: Orthodox fungal aquaporins / 25.82.1 / Yes / F: TGGCCCTGCTGAAATCAACT
R: CCCATTGCGAGTCTCTTCGT / Lacbi1:392091 (Lacbi2:456764)
H2O
JQ585593 / AFJ15556 / 330 / 6 / NPC, NSA / F G I R / Plasma membrane RC 5 / II: Fungal aquaglyceroporin / 46.610.2 / Yes / F: GTGACATTGGTTGCCGTTTG
R: ATCCTCCCGCAGCTGACTTT / Lacbi1:307192 (Lacbi2:671860)
JQ585594 / AFJ15557 / 254 / 6 / NPA, NPA / W G Y R / Secretory
RC 1 / III: Facultative fungal aquaporin / 124.011.0 / No / F: TAATGGCGCACTCACAAACG
R: ATGCCCCAAGACCAATGAAC / Lacbi1:247946 (Lacbi2:568479) H2O
JQ585595 / AFJ15558 / 312 / 6 / NPA, NPA / W I Y R / Plasma membrane RC 1 / III: Facultative fungal aquaporin / 260.08.9 / No / F: TAACCCCGCTCGTGATCTTG
R: CCTGTCTTCCATAGCCAACCA / Lacbi1:391485 (Lacbi2:443240) H2O, glycerol, ammonia
JQ585596 / AFJ15559 / 332 / 6 / NPA, NPA / W G Y R / Plasma membrane RC 3 / III: Facultative fungal aquaporin / 166.52.7 / No / F: ACGCTTGTTCCTCGCTATGTC
R: TGCCCAGAGCCAATATTGACT / Lacbi1:317173 (Lacbi2:317173) H2O, ammonia
JQ585597 / AFJ15560 / 332 / 6 / NPA, NPA / W G Y R / Plasma membrane RC 3 / III: Facultative fungal aquaporin / 138.41.5 / No / F: CGCCCTCACTGACAAACGTA
R: ATAAAGAGCGCAAATGGCAAAA / Lacbi1:317173 (Lacbi2:317173) H2O, ammonia

Note:

1. GenBank accession number in NCBI.

2. The number of transmembrane helix domains was predicted by TMHMM server 2.0 (Xu et al. 2015).

3. Subcellular localization was predicted by Target P (Emanuelsson et al. 2000); 1 indicated strongest prediction and 5 the weakest.

4. Phylogenetic analysis was refereed to Xu et al. 2013.

5. Pf was water permeability determined in Xenopus laevis oocyte assay (Xu et al. 2015); Pf for negative control was 20.50.6 μm s-1.

6. The assay was conducted in yeast heterologous expression system by Navarro-Ródenas et al. (unpublished).

7. F and R referred to forward and reverse primers, respectively.

8. Functional assays were conducted by Dietz et al. (2011); Lacbi2 proteins were searched in JGI Laccaria bicolor genome V2.0.