SupplementaryTables
Table S1: Primary and secondary antibodies used for western blot analyses
Antibody / Manufacturer / Order number / DilutionAnti-Flt3/CD135 Antibody / Abcam / Ab73019 / 1:100 in 5% BSA in TBST
Anti-ß-Actin Antibody / Sigma / A1978 / 1:2000 in 5% milk in TBST
Anti-Phosphotyrosine Antibody (4G10) / Merck Millipore / 05-321 / 1:100 in 5% milk in TBST
Anti-ULK1 Antibody / Abcam / ab128859 / 1:1000 in 5% milk in TBST
Cleaved PARP (Asp214) Antibody (Human Specific) / Cell Signaling / 9541 / 1:1000 in 5% milk in TBST
Flt-3/Flk-2 Antibody (C-20) / Santa Cruz / sc-479 / 1:50 in 5% milk in TBST
GAPDH Antibody (FL-335) / Santa Cruz / sc-25778 / 1:2000 in 5% milk in TBST
LC3B Antibody / Cell Signaling / 2775 / 1:500 in 5% milk in TBST
Mouse Flt-3/Flk-2 Antibody / R&D / MAB768 / 1:100 in 5% milk in TBST
Mouse Ret Antibody / R&D / MAB482 / 1:100 in 5% milk in TBST
p70 S6 Kinase Antibody / Cell Signaling / 9202 / 1:1000 in 5% BSA in TBST
Phospho-p70 S6 Kinase (Thr389) (108D2) Rabbit mAb / Cell Signaling / 9234 / 1:1000 in 5% BSA in TBST
Phospho-S6 Ribosomal Protein (Ser240/244) Antibody / Cell Signaling / 2215 / 1:1000 in 5% BSA in TBST
Phospho-STAT5 (Tyr694) Antibody / Cell Signaling / 9351 / 1:1000 in 5% BSA in TBST
Phospho-ULK1 (Ser757) (D706U) Rabbit mAb / Cell Signaling / 14202 / 1:1000 in 5% BSA in TBST
Purified Mouse Anti-p62 lck ligand / Becton Dickinson / 610832 / 1:1000 in 5% milk in TBST
Human Ret Antibody / R&D / AF1485 / 1:100 in 5% milk in TBST
S6 Ribosomal Protein (54D2) Mouse mAB / Cell Signaling / 2317 / 1:1000 in 5% milk in TBST
S6 Ribosomal Protein (5G10) Rabbit mAb / Cell Signaling / 2217 / 1:1000 in 5% BSA in TBST
SQSTM1/p62 Antibody / Cell Signaling / 5114 / 1:1000 in 5% BSA in TBST
STAT5 Antibody (C-17) / Santa Cruz / sc-835 / 1:200 in 5% milk in TBST
ULK1 (D8H5) Rabbit mAb / Cell Signaling / 8054 / 1:1000 in 5% BSA in TBST
Amersham ECL Mouse IgG, HRP-linked whole Ab (from sheep) / GE Healthcare / NA931 / 1:5000 in 5% milk in TBST
Amersham ECL Rabbit IgG, HRP-linked whole Ab (from donkey) / GE Healthcare / NA934 / 1:5000 in 5% milk in TBST
Rabbit anti-goat IgG antibody, HRP conjugate / Santa Cruz / sc-2922 / 1:5000 in 5% milk in TBST
Goat anti-rat IgG antibody, HRP conjugate / Santa Cruz / sc-2032 / 1:5000 in 5% milk in TBST
Table S2: AML cell lines investigated for RET mutations within the CCLE project
AML-193 / KG-1 / NB-4 / THP-1CMK-11-5 / KO52 / OCI-AML2 / UT-7
CMK / M-07e / OCI-AML3
EOL-1 / ME-1 / OCI-AML5
F-36P / MOLM-13 / OCI-M1
GDM-1 / MOLM-16 / P31/FUJ
HEL 92.1.7 / MONO-MAC-1 / PL-21
HEL / MONO-MAC-6 / SIG-M5
Kasumi-1 / MUTZ-3 / SKM-1
Kasumi-6 / MV-4-11 / TF-1
1
Table S3: AML patients analyzed by immunohistochemistry
Patient / Gender / De novo or secondary AML / Age at diagnosis [yr] / FLT3 status / FAB type / Karyotype / RET IRS / FLT3 IRS / p62 IRS1 / Male / De novo / 49 / Wildtype / M5 / Normal / 12 / 10 / 7.5
2 / Female / De novo / 64 / Wildtype / M4 / NA / 12 / 10 / 5
3 / Male / De novo / 64 / NA / M6 / Complex / 12 / 12 / 4
4 / Male / Secondary / 48 / Wildtype / M3 / t(15;17) / 12 / 9 / 3
5 / Female / De novo / 43 / NA / M0 / Normal / 12 / 9 / 3
6 / Male / De novo / 63 / Wildtype / M4 / Normal / 12 / 8.5 / 3
7 / Male / De novo / 77 / Wildtype / M2 / Normal / 12 / NA / 2
8 / Female / De novo / 52 / Wildtype / M5 / del(9q) / 12 / 12 / 2
9 / Male / Secondary / 41 / NA / M2 / Complex / 12 / 12 / 2
10 / Male / De novo / 51 / Wildtype / M3 / t(15;17) / 12 / 8.5 / 2
11 / Female / De novo / 43 / Wildtype / M3 / 47,XX,t(15;17),+8 / 12 / 8 / 2
12 / Female / NA / 58 / NA / M2 / NA / 12 / 8 / 2
13 / Female / Secondary / 70 / Wildtype / M5 / 46,XX,del(5)(q14q33)[1]/48,idem,+21,+21[19]
FISH: nuc ish 5p15.2(D5S721:D5S23x2), 5y31(EGR1x1)[250/254] / 12 / 8 / 2
14 / Female / Secondary / 60 / Wildtype / M4 / Not normal / 12 / 8.5 / 1.5
15 / Male / De novo / 73 / NA / M1 / Normal / 12 / 12 / 1
16 / Female / De novo / 75 / Wildtype / M5 / Normal / 12 / 12 / 1
17 / Male / De novo / 36 / Wildtype / M2 / Normal / 12 / 12 / 1
18 / Male / De novo / 75 / Wildtype / M0 / Not normal / 12 / 10.5 / 1
19 / Male / De novo / 64 / Wildtype / M2 / Normal / 12 / 10.5 / 1
20 / Male / De novo / 27 / Mutant / NA / Normal / 12 / 10 / 1
21 / Male / De novo / 70 / Mutant / M5 / Normal / 12 / 10 / 1
22 / Female / Secondary / 64 / Wildtype / M1 / Normal / 12 / 9 / 1
23 / Male / De novo / 43 / Mutant / M4 / Normal / 12 / 8 / 1
24 / Male / De novo / 55 / Wildtype / M0 / +8 / 12 / 12 / 0
25 / Male / De novo / 45 / Wildtype / M4 / Normal / 12 / 12 / 0
26 / Male / De novo / 67 / Mutant / M1 / Normal / 12 / 9 / 0
27 / Male / Secondary / 85 / Wildtype / M5 / Normal / 12 / 7.5 / 0
28 / Male / De novo / 68 / Mutant / M1 / Not normal / 12 / 7 / 0
29 / Male / De novo / 42 / Wildtype / M5 / Normal / 10.5 / 10 / 2
30 / Male / De novo / 41 / Wildtype / M2 / t(8;21) / 10.5 / 9 / 2
Table S3 continued: AML patients analyzed by immunohistochemistry
Patient / Gender / De novo or secondary AML / Age at diagnosis [yr] / FLT3 status / FAB type / Karyotype / RETIRS / FLT3 IRS / p62 IRS31 / Male / De novo / 72 / Mutant / M5 / Normal / 10.5 / 7.5 / 1
32 / Male / Secondary / 52 / NA / M5 / 46,XY,der(5)t(5;15)(q11;q13),ins(14;5)
(p13;q11q13),der(15)t(5;15)(q13;q13)[17]/46,XY[1] / 10.5 / 6 / 1
33 / Male / De novo / 75 / NA / NA / Normal / 10.5 / 9 / 0
34 / Female / De novo / 74 / Wildtype / M4 / Not normal / 10.5 / 8.5 / 0
35 / Male / De novo / 75 / Mutant / M4 / Normal / 10.5 / 7 / 0
36 / Male / De novo / 23 / Wildtype / M4 / t(3;5) / 10 / 8.5 / 5
37 / Male / Secondary / 62 / NA / M2 / Normal / 10 / 9 / 4
38 / Female / De novo / 64 / Wildtype / M2 / Normal / 10 / 8.5 / 3
39 / Female / De novo / 42 / Mutant / M5 / Normal / 10 / 10.5 / 2
40 / Female / De novo / 30 / Wildtype / M5 / Normal / 10 / 10.5 / 1
41 / Female / Secondary / 82 / NA / M2 / Not normal / 9 / 9 / NA
42 / Male / De novo / 74 / Wildtype / M4 / Normal / 9 / 10 / 6
43 / Male / De novo / 71 / NA / M1 / Not normal / 9 / 6 / 6
44 / Female / De novo / 63 / Wildtype / M5 / Normal / 9 / 9 / 4
45 / Male / Secondary / 69 / Mutant / M5 / der(1) / 9 / 9 / 3
46 / Female / De novo / 64 / Wildtype / M2 / Normal / 9 / 9 / 2
47 / Male / Secondary / 63 / Wildtype / M2 / Normal / 9 / 8.5 / 2
48 / Female / De novo / 69 / Wildtype / M4 / inv(16) / 9 / 10 / 1.5
49 / Male / De novo / 28 / NA / M4 / Complex (46,X,-Y,+der(8),del(8),der(20),...) / 9 / 10.5 / 1
50 / Male / De novo / 79 / Wildtype / M3 / 46,XY,t(15;17) / 9 / 7.5 / 1
51 / Male / Secondary / 72 / Wildtype / M4 / +21 / 9 / 12 / 0
52 / Female / De novo / 67 / Wildtype / M5 / +6 / 9 / 10.5 / 0
53 / Male / De novo / 62 / NA / M5 / Normal / 9 / 9 / 0
54 / Female / Secondary / 51 / NA / M4 / Complex / 9 / 8 / 0
55 / Female / De novo / 76 / Mutant / M2 / Normal / 8.5 / 6 / 0
56 / Female / De novo / 70 / Mutant / M1 / Normal / 8 / 9 / NA
57 / Male / Secondary / 60 / NA / M4 / inv(9) / 8 / 4 / 8
58 / Female / De novo / 57 / Wildtype / M5 / Normal / 8 / 12 / 2
59 / Female / De novo / 44 / Wildtype / M4 / Normal / 8 / 7.5 / 0
60 / Male / Secondary / 59 / Wildtype / M2 / Normal / 7.5 / NA / 1
Table S3 continued: AML patients analyzed by immunohistochemistry
Patient / Gender / De novo or secondary AML / Age at diagnosis [yr] / FLT3 status / FAB type / Karyotype / RET IRS / FLT3 IRS / p62 IRS61 / Female / Secondary / 66 / Wildtype / M5 / t(3;3),-7 / 7.5 / 10 / 1
62 / Female / De novo / 54 / Mutant / M3 / t(15;17) / 7.5 / 7.5 / 0
63 / Male / Secondary / 74 / Wildtype / M5 / Normal / 7.5 / 4 / 0
64 / Female / De novo / 75 / NA / M2 / Normal / 7 / 6 / 4.5
65 / Female / De novo / 57 / Wildtype / M5 / Normal / 7 / 10.5 / 3
66 / Male / De novo / 68 / NA / M5 / Normal / 7 / 12 / 2
67 / Male / De novo / 78 / NA / M5 / NA / 7 / 10.5 / 1.5
68 / Female / De novo / 64 / Wildtype / M6 / Normal / 6.5 / 12 / 2.5
69 / Female / De novo / 61 / Wildtype / M5 / Normal / 6.5 / 8.5 / 2
70 / Male / De novo / 63 / Wildtype / M5 / Normal / 6.5 / 7.5 / 2
71 / Female / De novo / 44 / Wildtype / M5 / Normal / 6.5 / 7.5 / 1,5
72 / Male / Secondary / 58 / NA / M5 / Normal / 6 / 6 / NA
73 / Female / De novo / 21 / Wildtype / M5 / Normal / 6 / 10 / 12
74 / Male / Secondary / 64 / NA / M2 / inv(9) / 6 / 6 / 7
75 / Male / Secondary / 58 / Wildtype / M6 / Not normal / 6 / 6.5 / 5
76 / Female / De novo / 28 / Wildtype / M6 / Normal / 6 / 9 / 4
77 / Female / De novo / 21 / NA / M4 / inv(16) / 6 / 2 / 4
78 / Male / Secondary / 41 / Wildtype / M5 / inv(3),-7 / 6 / 7.5 / 3.5
79 / Male / Secondary / 69 / Wildtype / M4 / Normal / 6 / 10.5 / 2
80 / Female / De novo / 69 / Mutant / M5 / Normal / 6 / 9 / 1
81 / Female / Secondary / 64 / NA / M2 / Not normal / 6 / 7.5 / 1
82 / Female / De novo / 66 / Mutant / M5 / Not normal / 6 / 9 / 0
83 / Male / De novo / 70 / NA / M4 / Normal / 6 / 6 / 0
84 / Male / De novo / 51 / NA / M5 / Not normal / 5.5 / 9 / 3.5
85 / Male / De novo / 38 / Wildtype / M2 / del(9q) / 5.5 / 7.5 / 1
86 / Male / De novo / 65 / NA / M0 / t(9;22) / 5 / 7.5 / 0
87 / Male / De novo / 25 / NA / M4 / inv(16) / 4.5 / 7.5 / 1
88 / Female / De novo / 61 / NA / M2 / Normal / 4.5 / 7.5 / 1
89 / Male / De novo / 71 / Wildtype / M5 / NA / 4.5 / 6.5 / 1
90 / Male / De novo / 70 / Wildtype / M4 / Not normal / 4.5 / 9 / 0
91 / Female / Secondary / 67 / Wildtype / M5 / Normal / 4.5 / 8.5 / 0
92 / Male / De novo / 64 / Wildtype / M1 / iso(21)(q10) / 4 / 10.5 / 3
Table S3 continued: AML patients analyzed by immunohistochemistry
Patient / Gender / De novo or secondary AML / Age at diagnosis [yr] / FLT3 status / FAB type / Karyotype / RET IRS / FLT3 IRS / p62 IRS93 / Male / Secondary / 65 / Mutant / M5 / 46,XY,inv(3)(q21q26) / 4 / 4 / 2
94 / Male / De novo / 39 / NA / M4 / Not normal / 4 / 3 / 2
95 / Female / De novo / 55 / Wildtype / M1 / Normal / 4 / NA / 1
96 / Male / Secondary / 56 / Wildtype / M4 / +Y,+13 / 4 / 12 / 1
97 / Male / De novo / 60 / Mutant / NA / Normal / 4 / 7.5 / 1
98 / Female / Secondary / 57 / NA / M4 / NA / 4 / 6 / 1
99 / Male / De novo / 53 / NA / NA / Not normal / 4 / 5 / 1
100 / Male / De novo / 73 / Wildtype / M1 / del(1q),del(4q) / 4 / 9 / 0
101 / Female / De novo / 41 / NA / M4 / Not normal / 4 / 6 / 0
102 / Female / Secondary / 64 / Mutant / M5 / Normal / 3.5 / 10.5 / 2
103 / Female / Secondary / 46 / Mutant / M5 / Normal / 3.5 / 9 / 1
104 / Male / Secondary / 76 / Wildtype / M1 / Normal / 3 / 7.5 / 1
105 / Female / NA / 80 / Mutant / M5 / Not normal / 3 / 9 / 0
106 / Female / Secondary / 58 / NA / M4 / Normal / 3 / 7 / 0
107 / Male / De novo / 76 / Wildtype / M1 / t(9;22) / 3 / 6 / 0
108 / Female / De novo / 74 / Wildtype / M1 / Normal / 2.5 / 9 / 2.5
109 / Male / De novo / 28 / Wildtype / M4 / -7 / 2.5 / 9 / 2
110 / Male / Secondary / 63 / Wildtype / M5 / 47,XYY[8]/48,XYYY[2] / 2.5 / 6 / 1.5
111 / Female / De novo / 54 / NA / M4 / NA / 2 / 6 / 2
112 / Male / Secondary / 62 / Wildtype / M1 / Complex / 2 / 7 / 1
113 / Male / De novo / 25 / Wildtype / M4 / inv(3),-7 / 2 / 4 / 0
114 / Male / Secondary / 72 / NA / M7 / Complex / 2 / 2 / 0
115 / Male / Secondary / 68 / Wildtype / M4 / Normal / 1 / 8 / 10
116 / Female / Secondary / 76 / NA / M5 / Complex / 1 / 4 / 0
117 / Male / De novo / 65 / Wildtype / M1 / Duplication of 11q at diagnosis, additional duplication of 7q two months later / 0 / NA / NA
118 / Female / De novo / 58 / Mutant / M1 / Normal / 0 / 6 / 0
119 / Male / De novo / 46 / Wildtype / M2 / Normal / 0 / 4 / 0
120 / Male / De novo / 51 / Wildtype / M1 / Normal / NA / 6 / NA
121 / Male / De novo / 70 / NA / M5 / Normal / NA / 6 / NA
122 / Female / De novo / 46 / Wildtype / M1 / t(2;3) / NA / NA / 4
123 / Female / Secondary / 55 / Mutant / M5 / Normal / NA / NA / 4
Table S3 continued: AML patients analyzed by immunohistochemistry
Patient / Gender / De novo or secondary AML / Age at diagnosis [yr] / FLT3 status / FAB type / Karyotype / RET IRS / FLT3 IRS / p62 IRS124 / Male / De novo / 22 / Wildtype / M4 / Normal / NA / 7.5 / 2
125 / Male / De novo / 30 / NA / M4 / Complex / NA / NA / 0
126 / Male / De novo / 74 / NA / M5 / t(1;3),-7 / NA / 12 / 0
127 / Male / Secondary / 64 / Wildtype / M4 / Not normal / NA / 9 / 0
FAB, French-American-British classification; IRS, immunoreactive score; NA, not analyzed
1
Table S4: Hallmark genes of mTORC1 signaling used for GSEA
Gene / Gene rank in queried gene expression profile / Rank metric score / Running enrichment score / Core enrichmentVLDLR / 157 / 1.938 / 0.022 / Yes
CDKN1A / 184 / 1.872 / 0.0467 / Yes
CFP / 221 / 1.792 / 0.0672 / Yes
ACSL3 / 244 / 1.77 / 0.0914 / Yes
DDIT4 / 267 / 1.731 / 0.1149 / Yes
WARS / 312 / 1.683 / 0.1311 / Yes
LDLR / 381 / 1.598 / 0.1386 / Yes
GGA2 / 409 / 1.574 / 0.1579 / Yes
INSIG1 / 522 / 1.496 / 0.1506 / Yes
HSP90B1 / 572 / 1.471 / 0.1615 / Yes
ACTR2 / 587 / 1.465 / 0.1828 / Yes
ERO1L / 723 / 1.403 / 0.167 / Yes
ALDOA / 746 / 1.395 / 0.1847 / Yes
MTHFD2 / 755 / 1.392 / 0.2065 / Yes
G6PD / 764 / 1.389 / 0.2283 / Yes
IDH1 / 877 / 1.351 / 0.2184 / Yes
SSR1 / 913 / 1.341 / 0.2313 / Yes
IGFBP5 / 990 / 1.317 / 0.2315 / Yes
TPI1 / 1036 / 1.302 / 0.2408 / Yes
CANX / 1154 / 1.268 / 0.228 / Yes
ACTR3 / 1193 / 1.255 / 0.2385 / Yes
YKT6 / 1213 / 1.249 / 0.2545 / Yes
ENO1 / 1218 / 1.249 / 0.275 / Yes
SCD / 1279 / 1.229 / 0.2785 / Yes
PGK1 / 1374 / 1.204 / 0.2714 / No
SLC6A6 / 1487 / 1.137 / 0.2578 / No
IDI1 / 1659 / 0.83 / 0.2213 / No
ELOVL5 / 1736 / 0.818 / 0.2128 / No
PITPNB / 1755 / 0.815 / 0.2217 / No
TM7SF2 / 1782 / 0.812 / 0.228 / No
SORD / 1888 / 0.799 / 0.2106 / No
FADS2 / 1898 / 0.798 / 0.2218 / No
HMGCS1 / 1912 / 0.796 / 0.2318 / No
IMMT / 2105 / 0.776 / 0.1881 / No
RDH11 / 2201 / 0.765 / 0.173 / No
POLR3G / 2225 / 0.762 / 0.1794 / No
ELOVL6 / 2284 / 0.755 / 0.1753 / No
TFRC / 2469 / 0.73 / 0.1331 / No
UBE2D3 / 2556 / 0.717 / 0.12 / No
GBE1 / 2571 / 0.715 / 0.1282 / No
PSMA3 / 2603 / 0.71 / 0.1313 / No
PSMG1 / 2763 / 0.684 / 0.0958 / No
EBP / 2766 / 0.684 / 0.1071 / No
EEF1E1 / 2773 / 0.683 / 0.1172 / No
QDPR / 2903 / 0.656 / 0.0902 / No
MTHFD2L / 2932 / 0.648 / 0.0931 / No
Table S4 continued: Hallmark genes of mTORC1 signaling used for GSEA
Gene / Gene rank in queried gene expression profile / Rank metric score / Running enrichment score / Core enrichmentMLLT11 / 3042 / 0.62 / 0.0714 / No
CALR / 3206 / 0.563 / 0.0326 / No
TMEM97 / 3234 / 0.552 / 0.0341 / No
FAM129A / 3320 / 0.495 / 0.0174 / No
RIT1 / 3350 / 0.456 / 0.0167 / No
Table S5: Autophagy-associated genes used for GSEA
Gene / Gene rank in queried gene expression profile / Rank metric score / Running enrichment score / Core enrichmentBAG3 / 32 / 2.704 / 0.0133 / Yes
TP53INP2 / 69 / 2.336 / 0.0223 / Yes
CTSH / 90 / 2.211 / 0.0350 / Yes
CAPN2 / 108 / 2.123 / 0.0479 / Yes
GNS / 143 / 1.997 / 0.0546 / Yes
CASP1 / 177 / 1.885 / 0.0607 / Yes
CDKN1A / 184 / 1.872 / 0.0748 / Yes
CTSD / 205 / 1.826 / 0.0842 / Yes
HEXB / 209 / 1.816 / 0.0988 / Yes
CTSL1 / 216 / 1.801 / 0.1123 / Yes
FUCA1 / 234 / 1.778 / 0.1222 / Yes
CTSB / 243 / 1.771 / 0.1349 / Yes
ATP6V0E2 / 306 / 1.686 / 0.1305 / Yes
TNFSF10 / 313 / 1.683 / 0.1429 / Yes
SGSH / 315 / 1.678 / 0.1569 / Yes
GAA / 346 / 1.628 / 0.1617 / Yes
PRKCD / 363 / 1.612 / 0.1705 / Yes
MAP1LC3A / 378 / 1.600 / 0.1799 / Yes
NAGA / 395 / 1.584 / 0.1885 / Yes
PSAP / 426 / 1.559 / 0.1927 / Yes
RAC1 / 458 / 1.536 / 0.1964 / Yes
ARL8B / 459 / 1.535 / 0.2094 / Yes
RAB24 / 544 / 1.483 / 0.1967 / Yes
SCARB2 / 557 / 1.477 / 0.2056 / Yes
SESN2 / 573 / 1.471 / 0.2135 / Yes
WIPI1 / 603 / 1.455 / 0.2172 / Yes
ATP6V0E1 / 624 / 1.450 / 0.2234 / Yes
P4HB / 651 / 1.437 / 0.2278 / Yes
ATP6V0B / 656 / 1.433 / 0.2388 / Yes
ARSA / 660 / 1.432 / 0.2500 / Yes
LAMP2 / 720 / 1.405 / 0.2441 / Yes
ERO1L / 723 / 1.403 / 0.2555 / Yes
PEA15 / 730 / 1.401 / 0.2655 / Yes
TPP1 / 747 / 1.395 / 0.2726 / Yes
GM2A / 752 / 1.393 / 0.2832 / Yes
VAMP1 / 763 / 1.389 / 0.2920 / Yes
PIK3CG / 796 / 1.379 / 0.2940 / Yes
GLB1L / 802 / 1.375 / 0.3042 / Yes
BIRC5 / 818 / 1.371 / 0.3113 / Yes
CTSL2 / 868 / 1.353 / 0.3080 / Yes
HGSNAT / 927 / 1.337 / 0.3018 / Yes
KIAA0226 / 941 / 1.332 / 0.3092 / Yes
RHEB / 950 / 1.328 / 0.3181 / Yes
GBA / 983 / 1.319 / 0.3196 / Yes
MAP1LC3B / 984 / 1.319 / 0.3308 / Yes
ATP6V0C / 999 / 1.316 / 0.3378 / Yes
Table S5 continued: Autophagy-associated genes used for GSEA
Gene / Gene rank in queried gene expression profile / Rank metric score / Running enrichment score / Core enrichmentDPP7 / 1047 / 1.300 / 0.3346 / Yes
SMPD1 / 1050 / 1.299 / 0.3451 / Yes
CANX / 1154 / 1.268 / 0.3248 / Yes
RAB7A / 1159 / 1.268 / 0.3343 / Yes
FKBP1A / 1209 / 1.251 / 0.3301 / Yes
CLCN5 / 1238 / 1.242 / 0.3322 / Yes
SPNS1 / 1239 / 1.242 / 0.3428 / Yes
TM9SF1 / 1265 / 1.234 / 0.3457 / Yes
BECN1 / 1311 / 1.220 / 0.3425 / Yes
ATP6V0A1 / 1329 / 1.216 / 0.3477 / Yes
TMEM63A / 1353 / 1.210 / 0.3510 / Yes
GABARAP / 1362 / 1.208 / 0.3589 / Yes
ATG3 / 1367 / 1.207 / 0.3679 / Yes
CAMKK2 / 1385 / 1.200 / 0.3730 / Yes
MAPK9 / 1394 / 1.197 / 0.3807 / Yes
KIAA0652 / 1408 / 1.191 / 0.3869 / Yes
ARNT / 1420 / 1.187 / 0.3937 / Yes
NRG2 / 1476 / 1.154 / 0.3869 / No
NRG1 / 1837 / 0.805 / 0.2850 / No
ATP6V0A2 / 1849 / 0.803 / 0.2885 / No
GABARAPL2 / 1972 / 0.788 / 0.2584 / No
ST13 / 1984 / 0.788 / 0.2618 / No
GNB2L1 / 2008 / 0.785 / 0.2615 / No
CFLAR / 2080 / 0.778 / 0.2467 / No
BNIP1 / 2084 / 0.778 / 0.2524 / No
PTEN / 2087 / 0.777 / 0.2584 / No
NAF1 / 2142 / 0.772 / 0.2486 / No
RB1CC1 / 2189 / 0.766 / 0.2412 / No
FAM48A / 2212 / 0.764 / 0.2411 / No
BIRC6 / 2231 / 0.762 / 0.2421 / No
KIAA0831 / 2275 / 0.755 / 0.2356 / No
IDS / 2347 / 0.747 / 0.2205 / No
RPS6KB1 / 2370 / 0.744 / 0.2201 / No
PEX3 / 2440 / 0.733 / 0.2055 / No
EIF2AK2 / 2441 / 0.733 / 0.2118 / No
CALCOCO2 / 2456 / 0.731 / 0.2138 / No
USP10 / 2464 / 0.730 / 0.2178 / No
FOXO3 / 2507 / 0.725 / 0.2113 / No
GOPC / 2681 / 0.698 / 0.1650 / No
MAP2K7 / 2735 / 0.690 / 0.1549 / No
BNIP3L / 2808 / 0.676 / 0.1389 / No
CASP3 / 2929 / 0.648 / 0.1081 / No
BCL2L1 / 2954 / 0.642 / 0.1064 / No
MYC / 2966 / 0.641 / 0.1085 / No
ITGA6 / 3002 / 0.629 / 0.1033 / No
ATG16L2 / 3028 / 0.623 / 0.1010 / No
Table S5 continued: Autophagy-associated genes used for GSEA
Gene / Gene rank in queried gene expression profile / Rank metric score / Running enrichment score / Core enrichmentATG16L1 / 3033 / 0.621 / 0.1051 / No
PRKCQ / 3345 / 0.459 / 0.0151 / No
DLC1 / 3387 / 0.359 / 0.0057 / No
Table S6: FLT3-ITD-positive AML patients analyzed by methylcellulose and apoptosis assays
Patient / Gender / De novo or secondary AML / Age at diagnosis [yr] / FLT3-ITD/WT allelic ratio / Karyotype / Additional mutations / Isolated from1 / NA / NA / 73 / NA / NA / NA / BM
2 / Female / De novo / 51 / 0.58 / Normal / NPM1 / PB
3 / Male / De novo / 66 / 3.8 / 46,XY,t(6;9) (p23;q34)[25] / CEBPA / BM
4 / Male / De novo / 66 / 0.29 / Normal / NPM1, CEPBA / BM
5 / Male / De novo / 68 / 0.95 / Normal / NPM1 / BM
6 / Male / De novo / 47 / 0.51 / Normal / NPM1 / BM
7 / Female / Secondary / 21 / 0.50 / Normal / NPM1 / BM
NA, not analyzed
Table S7: Primers used for qRT-PCR based on SYBR Green
Gene / Forward primer / Reverse primerRet / TCCTTTGTCCCAACATCAGTG / CCTCCAGCACATACTTCTCC
Hprt1 / CTTTGCTGACCTGCTGGATT / TATGTCCCCCGTTGACTGAT
RET / GAGAAGCTCAGTGTCCGC / GGAGGTGTTGAAGAAGGAGAAG
FLT3 / TGGACCTTCTCTCGAAAATCATTT / GCATCATCATTTTCTGCATGGA
HPRT1 / TTGCTGACCTGCTGGATTAC / TCTCCACCAATTACTTTTATGTCC
Table S8: TaqMan Assays used for qRT-PCR
Gene / Assay ID / Forward primer / Reverse primer / Probe (FAM)RET / Hs01120030_m1 / - / - / -
GFRA1 / Hs00237133_m1 / - / - / -
GFRA2 / Hs00176393_m1 / - / - / -
GFRA3 / Hs00181751_m1 / - / - / -
GFRA4 / Hs00941114_g1 / - / - / -
GDNF / Hs01931883_s1 / - / - / -
NRTN / Hs00177922_m1 / - / - / -
ARTN / Hs00754699_s1 / - / - / -
PSPN / Hs03986122_s1 / - / - / -
HPRT1 / Hs02800695_m1 / - / - / -
FLT3 / - / GCTTGTCACCCACGGGAAA / TGGTGTAGATGCCTTCAAACAGG / TGGTGAAGATATGTGACTTTGGATTGGCTCG
1
Table S9: shRNA constructs
Gene / Species / Source / Identifier / Oligonucleotide sequence / Name used in manuscript / Vector- / - / TRC-Hs 1.0, 1.5, and 2.0 (human) shRNA libraries / SHC002 / ACCGGCAACAAGATGAAGAGCACCAAGTTAATATTCATAGCTTGGTGCTCTTCATCTTGTTGTTTT / Non-targeting
control (NTC) / DECIPHER pRSI9-U6-sh-UbiC-TagRFP-2A-Puro, DECIPHER pRSI12-U6-sh-UbiC-TagRFP-2A-Puro-W
Ret / Mouse / TRC-Hs 2.0 (human) shRNA library / TRCN0000368724 / ACCGTCGGGCAACCATGCACAATTACTCGAGTAATTGTGCATGGTTGCCCGATTTT / Ret shRNA 1 / DECIPHER pRSI12-U6-sh-UbiC-TagRFP-2A-Puro-W
Ret / Mouse / TRC-Hs 2.0 (human) shRNA library / TRCN0000361446 / ACCGCAGGGCTTCCCAATCAGTTATCTCGAGATAACTGATTGGGAAGCCCTGTTTT / Ret shRNA 2 / DECIPHER pRSI12-U6-sh-UbiC-TagRFP-2A-Puro-W
Ret / Mouse / TRC-Hs 2.0 (human) shRNA library / TRCN0000361385 / ACCGCATTCCTTTGTGAACGGTAATCTCGAGATTACCGTTCACAAAGGAATGTTTT / Ret shRNA 3 / DECIPHER pRSI12-U6-sh-UbiC-TagRFP-2A-Puro-W
GFRA3 / Human / DECIPHER module 3 / CLL-H-63243 / ACCGGGCTGTGTACTCTCAATGATAAGTTAATATTCATAGCTTGTCATTGAGAGTACACAGCTTTT / GFRA3 shRNA 1 / DECIPHER pRSI9-U6-sh-UbiC-TagRFP-2A-Puro
GFRA3 / Human / DECIPHER module 3 / CLL-H-63245 / ACCGGGCAGCCTAGAAAGTTATTCTTG TTAATATTCATAGCGAGAATGACTTTCTAGGCTGCTTTT / GFRA3 shRNA 2 / DECIPHER pRSI9-U6-sh-UbiC-TagRFP-2A-Puro
- / - / TRC-Hs 1.0, 1.5, and 2.0 (human) shRNA libraries / SHC002 / CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTT / NTC / pLKO.1-puro,
pLKO.1-GFP
RET / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000000405 / CCGGGCTGCATGAGAACAACTGGATCTCGAGATCCAGTTGTTCTCATGCAGCTTTTTG / RET shRNA 1 / pLKO.1-puro,
pLKO.1-GFP
RET / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000040027 / CCGGCCTGTTTGTGAATGACACCAACTCGAGTTGGTGTCATTCACAAACAGGTTTTTG / RET shRNA 2 / pLKO.1-puro,
pLKO.1-GFP
RET / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000010239 / CCGGGCAAGGAGATGGCAAAGGGATCTCGAGATCCCTTTGCCATCTCCTTGCTTTTTG / RET shRNA 3 / pLKO.1-puro,
pLKO.1-GFP
Table S9 continued: shRNA constructs
Gene / Species / Source / Identifier / Oligonucleotide sequence / Name used in manuscript / VectorFLT3 / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000000773 / CCGGGCTAACTTCTACAAACTGATTCTCGAGAATCAGTTTGTAGAAGTTAGCTTTTTG / FLT3 shRNA 1 / pLKO.1-puro,
pLKO.1-GFP
GFRA2 / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000060709 / CCGGCCTGAATGACAACTGCAAGAACTCGAGTTCTTGCAGTTGTCATTCAGGTTTTTG / GFRA2 shRNA 1 / pLKO.1-puro,
pLKO.1-GFP
GFRA2 / Human / TRC-Hs 2.0 (human) shRNA library / TRCN0000419596 / CCGGGGGAACCGAGTCAGAATATTTCTCGAGAAATATTCTGACTCGGTTCCCTTTTTTG / GFRA2 shRNA 2 / pLKO.1-puro,
pLKO.1-GFP
NRTN / Human / TRC-Hs 2.0 (human) shRNA library / TRCN0000377476 / CCGGAGTGCTCTGCAGCTCCGTGCTCTCGAGAGCACGGAGCTGCAGAGCACTTTTTTG / NRTN shRNA 1 / pLKO.1-puro,
pLKO.1-GFP
NRTN / Human / TRC-Hs 2.0 (human) shRNA library / TRCN0000376585 / CCGGATGTGTCGAGAGGGCCTGCTTCTCGAGAAGCAGGCCCTCTCGACACATTTTTTG / NRTN shRNA 2 / pLKO.1-puro,
pLKO.1-GFP
ARTN / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000109760 / CCGGCCTCTGGGAGAATCCAGAAATCTCGAGATTTCTGGATTCTCCCAGAGGTTTTTG / ARTN shRNA 1 / pLKO.1-GFP
ARTN / Human / TRC-Hs 1.0 (human) shRNA library / TRCN0000109763 / CCGGTCTCCTTCATGGACGTGAACACTCGAGTGTTCACGTCCATGAAGGAGATTTTTG / ARTN shRNA 2 / pLKO.1-GFP
1
Table S10: Antibodies and isotype controls used for flow cytometry
Antibody/isotype control / Manufacturer / Order number / DilutionFITC Rat Anti-mouse CD11b / BD Bioscience / 553310 / 1:100
Anti-mouse Ly-6G (Gr-1) APC / eBioscience / 17-5931-81 / 1:160
Anti-mouse CD117 (c-Kit) PE-Cy7 / eBioscience / 25-1171-81 / 1:20
APC-Cy7 Rat Anti-Mouse Ly-6A/E (Sca-1) / BD Bioscience / 560654 / 1:40
Anti-Hu/Mo CD45R (B220) FITC / eBioscience / 11-0452-81 / 1:100
Anti-Mouse CD3 APC / eBioscience / 17-0032-80 / 1:40
FITC Rat IgG2b, k Isotype Control / BD Bioscience / 553988
Rat IgG2a K Isotype Control FITC / eBioscience / 11-4321-81
Rat IgG2bk isotype control APC / eBioscience / 17-4031-81
Rat IgG2bk isotype control PE-Cy7 / eBioscience / 25-4031-81
Table S11: Antibodies used for immunohistochemistry
Antibody / Manufacturer / Order number / DilutionAnti-Ret antibody / Abcam / ab134100 / 1:250
Anti-CD135/FLT3 Antibody (Internal) IHC-plus / LifeSpan BioSciences / LS-A7148 / 1:100
Anti-SQSTM1/p62 antibody / Abcam / ab56416 / 1:50
1
SupplementaryMethods
RNA isolation, cDNA synthesis, and qRT-PCR
Total RNA was isolated using the RNeasy (Plus) Mini or Micro Kit (Qiagen), and cDNA was synthesized from 2 µg of total RNA in a total volume of 20 µl (High Capacity cDNA Reverse Transcription Kit, Applied Biosystems). qRT-PCRwas carried out by adding 10-300 ng/µl of cDNA and 10 µM of forward or reverse primer (Supplementary Table 7) to the LightCycler 480 SYBR Green I Master reagent (Roche) in a total volume of 10 µl,and samples were run on a LightCycler 480 under default conditions (initial denaturation at 95°C for 5 min, 40 cycles of denaturation at 95°C for 30 s,annealing/elongation at 60°C for 45 s, and melting curve between 60-95°C with five acquisitions per °C).Absolute quantification of target sequences was performed using the second derivative maximum method and a standard curve as reference. Values were normalized to endogenous HPRT1 (Hprt1). Alternatively, 100 ng/µl of cDNA and 0.5 µl of TaqMan Assay (Applied Biosystems; Supplementary Table 8) were added to the TaqMan Gene Expression Master Mix (Applied Biosystems) in a total volume of 10 µl, and samples were run on a LightCycler 480 under default conditions (initial denaturation at 95°C for 10 min, 40 cycles of denaturation at 95°C for 15 s, annealing/elongation at 60°C for 1 min).Gene expression was determined by calculating 2-Ct values from the Ct, which was defined as Ct(target gene)-Ct(HPRT1).
Protein analyses
To obtain whole-cell lysates, cells were washed twice with PBS, lysed in CHAPS buffer (1% CHAPS, 30 mM Tris-HCl, 150 mM NaCl, pH 7.3) or Triton X-100 buffer (1% Triton X-100, 10% Glycerol, 150 mM NaCl, 20 mM Tris-HCl, 5 mM EDTA, pH 8.0) containing phosphatase and protease inhibitors (Halt Protease and Phosphatase Inhibitor Cocktail, Thermo Scientific), and cleared by centrifugation at 13,000 rpm and 4°C for 10 min. Protein concentrationswere determined by Bradford assay (Biorad).For western blotting, 20-50 µg of protein were denatured in NuPAGE Sample Reducing Agent and NuPAGE LDS Sample Buffer at 95°C for 5 min. For detection of murine Flt3 and Ret, lysis was performed by incubating equal number of cells with SDS buffer (62.5 mM Tris-HCl, 2% SDS, 10% Glycerol, 50 mM DTT, 0.01% bromophenol blue, pH 6.8) at 95°C for 5 min, lysates were cleared by centrifugation at 13,000 rpm for 10 min, and 6 µl supernatant were used for SDS-polyacrylamide gel electrophoresis. For immunoprecipitation, 2.5 mg of protein were incubated with 10-50 µl of the RET (R&D) or FLT3 antibody (Santa Cruz, sc-19635) over night. Antigen/antibodycomplexes were isolated using Protein G Sepharose (GE Healthcare) and denatured as described above. Samples were subjected to SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose or PVDF membrane following standard methods. Ponceau S staining of transferred proteins was used to control for equal loading. According to the diluent of the primary antibody, membranes were blocked in either 5% BSA in TBST or 5% milk in TBST at room temperature for one hour and subsequently incubated with the primary antibody(Supplementary Table 1) at 4°C over night. Membranes were washed in TBST and incubated with the corresponding horseradish peroxidase-coupled secondary antibody(Supplementary Table 1) at room temperature for one hour. Chemiluminescent signals were obtained by exposing the membranes to ECLsolution and captured on autoradiography films.
Plasmids and viral transduction
Human RET, FLT3, GFRA2, NRTN, and ARTN shRNA sequences were taken from the TRC-Hs 1.0 and 2.0 (human) shRNA libraries and cloned into the pLKO.1-GFP or pLKO.1-puro lentiviral vectors. Human GFRA3 shRNA sequences were retrieved from the DECIPHER shRNA library (Cellecta) and cloned into the DECIPHER pRSI9-U6-sh-UbiC-TagRFP-2A-Puro vector (pRSI9-RFP, Cellecta). Murine Ret shRNA sequences were taken from the TRC-Mm 2.0 (mouse) shRNA library and cloned into the DECIPHER pRSI12-U6-sh-UbiC-TagRFP-2A-Puro-W vector (pRSI12-RFP, Cellecta). The sequences of all shRNAs are listed in Supplementary Table 9. The RET9 cDNA was a gift from William Hahn and David Root (Addgene #23906), and the RET51 isoform used in this study was generated from RET9 by restriction enzyme-based cloning. The FLT3-ITD (W51), FLT3-D835Y, Hoxa9/Meis1, MLL-AF9, and NRAS-G12D cDNAs were described before.1-4 cDNAs were cloned into the pLenti6.2/V5-DEST (RET51), MSCV-IRES-GFP (FLT3-ITD, FLT3-D835Y), MSCV-IRES (Hoxa9/Meis1), MSCV.neo (MLL-AF9), or pBABE.puro (NRAS-G12D) vectors, and correct sequences were confirmed by Sanger sequencing. Generation of lentiviral and retroviral supernatants and infection of cells were performed as described previously.1,5 When appropriate, transduced cells were selected with 2 µg/ml puromycin (Sigma-Aldrich) or 2.5 µg/ml blasticidin (Life Technologies).
Apoptosis, cell cycle, and cell competition analysis
For apoptosis measurements, cells were transduced with pLKO.1-puro shRNAs, followed by selection with 2 µg/ml puromycin for three days and removal of dead cells by density gradient centrifugation. Seven days after transduction, 1 x 105 cells were analyzed using the APC or FITC Annexin V Apoptosis Detection Kit (BD Pharmingen). For cell cycle analysis, cells were transduced with pLKO.1-GFP shRNAs at an efficiency of 80-95%, and5 x 105 cells were resuspended in 500 µl Nicoletti buffer (0.1% Triton X-100, 0.1% sodium citrate, 50 µg/ml propidium iodide in ddH2O) four days after transduction. To analyze cell depletion by gene knockdown in a competition assay, cells were transduced with pLKO.1-GFP shRNAs at a transduction efficiency of 33.6 to 73.1%, pRSI9-RFP or pRSI12-RFP shRNAs to obtain a mixed population of transduced and untransduced cells, and the proportion of GFP/RFP-positive cells was determined for 10 to 13 days by flow cytometry. All samples were analyzed on a BD LSRII or LSRFortessa flow cytometer (BD Biosciences). See Supplementary Table 9 for details on shRNA constructs.
Methylcellulose and apoptosis assays with primary AML patient samples
To assess viable cell numbers after RET inhibitor treatment of primary AML patient samples (Supplementary Table 6), 5 x 105 cells were plated in methylcellulose (Methocult H4435 enriched, Stem Cell Technologies) supplemented with the indicated inhibitors or DMSO in duplicates. After seven days, cells were counted using trypan blue exclusion. To measureapoptosis induction in primary AML patient samples, 0.5 x 106 cells/ml were cultured in StemPro-34 SFM medium (Gibco) supplemented with 2.6% nutrient supplement (Gibco), 1% penicillin/streptomycin, 1% L-glutamin, 2% FBS, 10 ng/ml FLT3L, 10 ng/ml SCF, 10 ng/ml TPO, 10 ng/ml IL-3, and the indicated concentrations of vandetanib, crenolanib, or a combination of both inhibitors for three days, and 1 x 105 cells were analyzed using the FITC Annexin V Apoptosis Detection Kit (BD Pharmingen).