Supporting Information
For
The behavior of antibiotic resistance genes and arsenic influenced by biochar during different manure composting
Erping Cui 1·Ying Wu 1·Yanan Jiao 1·Yiru Zuo 1·Christopher Rensing 2·Hong Chen 1
1 Department of Environmental Engineering, College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058, China, People’s Republic of China
2 Department of Agricultural Resources and the Environment, College of Resources and Environment, Fujian Agriculture and Forestry University, Fuzhou 350002, China, People’s Republic of China
Hong Chen
Captions:
Table S1: Characteristics of raw materials for lab-scale pig and duck manure composting.
Table S2: Primers and PCR conditions in this study.
Table S3: Standard curve of selected ARGs.
Table S4: Correlation coefficients between ARGs, total arsenic and bioavailable arsenic in pig and duck manure composting samples.
Fig. S1: Changes in temperature during pig manure composting (A) and duck manure composting (B) with or without biochar.
Fig. S2: Changes in pH during pig manure composting (A) and duck manure composting (B) with or without biochar.
Fig. S3: The removal value of ARGs in pig manure composting (A) and duck manure composting (B) with or without biochar.
References
Table S1：Characteristics of raw materials for lab-scale pig and duck manure composting.
Pig manure / 29.71 / 3.61 / 4.62 / 8.23 / 10.51
Duck manure / 27.73 / 3.31 / 3.48 / 8.38 / 9.86
Saw dust / 34.50 / 0.53 / 4.38 / 65.09 / 1.61
Rice straw biochar (RSB) / 49.71 / 0.62 / 1.68 / 80.18 / 2.89
Mushroom biochar (MB) / 55.72 / 2.81 / 1.82 / 19.83 / 6.79
Table S2: Primers and PCR conditions in this study.
Target genes / Primer / Sequences / Amplicon size (bp) / Annealing temperature (℃) / ReferencetetB / tetB-F / GGCAGGAAGAATAGCCACTAA / 151 / 63 / Ng et al. 2001
tetB-R / AGCGATCCCACCACCAG
tetL / tetL-F / TCGTTAGCGTGCTGTCATTC / 267 / 60
tetL-R / GTATCCCACCAATGTAGCCG
tetM / tetM-F / ACAGAAAGCTTATTATATAAC / 171 / 55 / Aminov et al. 2001
tetM-R / TGGCGTGTCTATGATGTTCAC
tetW / tetW-F / GAGAGCCTGCTATATGCCAGC / 168 / 60 / Luo et al. 2010
tetW-R / GGGCGTATCCACAATGTTAAC
tetQ / tetQ-F / AGAATCTGCTGTTTGCCAGTG / 169 / 62
tetQ-R / CGGAGTGTCAATGATATTGCA
tetX / tetX-F / AGCCTTACCAATGGGTGTAAA / 278 / 60 / Diehl et al. 2010
tetX-R / TTCTTACCTTGGACATCCCG
sul1 / sul1-F / CACCGGAAACATCGCTGCA / 158 / 55 / Ji et al. 2012
sul1-R / AAGTTCCGCCGCAAGGCT
sul2 / sul2-F / CTCCGATGGAGGCCGGTAT / 190 / 60 / Luo et al. 2010
sul2-R / GGGAATGCCATCTGCCTTGA
cfr / cfr-F / TGTGCTACAGGCAACATTGGAT / 148 / 55 / He et al. 2014
cfr-R / CAAATACTTGACGGTTGGCTAGAG
cmlA / cmlA-F / GCCAGCAGTGCCGTTTAT / 158 / 55
cmlA-R / GGCCACCTCCCAGTAGAA
fexA / fexA-F / ATTCTCCCGCAAATAACG / 156 / 52
fexA-R / TCGGCTCAGTAGCATCACG
floR / floR-F / CGGTCGGTATTGTCTTCACG / 171 / 56
floR-R / TCACGGGCCACGCTGTAT
16S rRNA / 1369F / CGGTGAATACGTTCYCGG / 143 / 55 / Gaze et al. 2011
1492R / GGWTACCTTGTTACGACTT
Table S3: Standard curve of selected ARGs.
Genes / Standard Curve / R2 / Amplification efficiency (%)tetB / y= -3.2646lgx+36.577 / 0.995 / 102.45
tetL / y= -3.3831lgx+35.554 / 0.997 / 97.51
tetM / y= -3.0742lgx+35.007 / 0.991 / 111.49
tetW / y= -3.2621lgx+35.954 / 0.999 / 102.56
tetQ / y= -3.4133lgx+38.565 / 0.999 / 96.32
tetX / y= -3.2628lgx+33.263 / 0.991 / 102.53
sul1 / y= -3.5172lgx+37.934 / 0.994 / 92.45
sul2 / y= -3.7637lgx+38.271 / 0.993 / 84.37
cfr / y= -3.4375lgx+36.322 / 0.992 / 95.39
cmlA / y= -3.2155lgx+40.864 / 0.993 / 104.64
fexA / y= -3.3729lgx+34.347 / 0.996 / 97.92
floR / y= -3.1814lgx+36.580 / 0.999 / 106.22
16S rRNA / y= -3.3040lgx+38.496 / 0.993 / 100.75
* “y” means the threshold cycle number (Ct value) determined during the qPCR, “x” is the gene copy number in the qPCR.
Table S4: Correlation coefficients between ARGs, total arsenic and bioavailable arsenic in pig and duck manure composting samples.
Pig manure composting samples / Duck manure composting samplesBioavailable arsenic / Total arsenic / Bioavailable arsenic / Total
arsenic
tetB / 0.788** / 0.854** / -0.082 / 0.034
tetL / 0.397* / 0.498** / -0.089 / 0.248*
tetM / 0.558** / 0.66** / -0.006 / 0.367*
tetW / -0.042 / 0.01 / 0.375* / 0.352*
tetQ / -0.089 / -0.089 / 0.424** / 0.196
tetX / 0.382* / 0.349* / -0.09 / 0.319*
sul1 / 0.425** / 0.421** / -0.091 / 0.222
sul2 / 0.242* / 0.213 / -0.081 / 0.199
cfr / 0.474** / 0.5** / -0.089 / 0.222
cmlA / -0.068 / -0.054 / 0.87** / 0.232
fexA / 0.193 / 0.301* / 0.133 / 0.422**
floR / 0.042 / 0.054 / -0.091 / 0.131
* Correlation significant at P < 0.05. ** Correlation significant at P < 0.01.
Fig. S1: Changes in temperature during pig manure composting (A) and duck manure composting (B) with or without biochar. PM: pig manure + saw dust; PM+RSB: pig manure + saw dust + RSB; PM+MB: pig manure + saw dust + MB; DM: duck manure + saw dust; DM+RSB: duck manure + saw dust + RSB; DM+MB: duck manure + saw dust + MB.
Fig. S2: Changes in pH during pig manure composting (A) and duck manure composting (B) with or without biochar. PM: pig manure + saw dust; PM+RSB: pig manure + saw dust + RSB; PM+MB: pig manure + saw dust + MB; DM: duck manure + saw dust; DM+RSB: duck manure + saw dust + RSB; DM+MB: duck manure + saw dust + MB.
Fig. S3: The removal value of ARGs in pig manure composting (A) and duck manure composting (B) with or without biochar. PM: pig manure + saw dust; PM+RSB: pig manure + saw dust + RSB; PM+MB: pig manure + saw dust + MB; DM: duck manure + saw dust; DM+RSB: duck manure + saw dust + RSB; DM+MB: duck manure + saw dust + MB.
References
Aminov RI, Garrigues-Jeanjean N, Mackie RI (2001) Molecular ecology of tetracycline resistance:
development and validation of primers for detection of tetracycline resistance genes encoding
ribosomal protection proteins. Appl Environ Microbiol 67: 22-32
Diehl DL, LaPara TM (2010) Effect of temperature on the fate of genes encoding tetracycline
resistance and the integrase of class 1 integrons within anaerobic and aerobic digesters treating
municipal wastewater solids. Environ Sci Technol 44: 9128-9133
Gaze WH, Zhang L, Abdouslam NA, Hawkey PM, Calvo-Bado L, Royle J, Brown H, Davis S, Kay P,
Boxall AB, Wellington EM (2011) Impacts of anthropogenic activity on the ecology of class 1
integrons and integron-associated genes in the environment. ISME J 5: 1253-1261
He LY, Liu YS, Su HC, Zhao JL, Liu SS, Chen J, Liu WR, Ying GG (2014) Dissemination of
antibiotic resistance genes in representative broiler feedlots environments: identification of
indicator ARGs and correlations with environmental variables. Environ Sci Technol 48:
13120-13129
Ji XL, Shen QH, Liu F, Ma J, Xu G, Wang YL, Wu MH (2012) Antibiotic resistance gene abundances
associated with antibiotics and heavy metals in animal manures and agricultural soils adjacent to
feedlots in Shanghai; China. J Hazard Mater 235-236: 178-185
Luo Y, Mao DQ, Rysz M, Zhou QX, Zhang HJ, Xu L, J JAP (2010) Trends in antibiotic resistance
genes occurrence in the Haihe River, China. Environ Sci Technol 44: 7220-7225
Ng LK, Martin I, Alfa M, Mulvey M (2001) Multiplex PCR for the detection of tetracycline resistant
genes. Mol Cell Probes 15: 209-215