Supplementary Table 1: Expression of TG2 and Psmad3 in Human Ovarian Tumors by Histological

Supplementary Material:

Supplementary Table 1: Expression of TG2 and pSMAD3 in human ovarian tumors by histological type

Materials and Methods:

Quantitative RT-PCR, probes and primers: The primers and probes used were:

In situ TG2 activity assay: In brief, cells were treated with TGF-or vehicle control for 48h, and incubated with 2 mM BPA 1h before harvesting. Equal amounts of protein containing 5mM EDTA or 5mM CaCl2 were run on SDS gels and transferred tonitrocellulose. Blots incubated with HRP-conjugated streptavidin (Pierce) were developed with ECL.

Matrigel Invasion Assay: Invasion assay was performed by using 2 dimensional (2D) and 3 dimensional (3D) cell culture in a matrigel matrix (BD-Biosciences, Palo, Alto). Briefly, 2.5 X 104 cells suspended in 50 µl cell culture media were seeded onto solidified matrigel in 24 well plates as a monolayer (2D model) or mixed and embedded within the matrix (3D model). After incubation at 37°C, invasive cells adhered to the surface of the gel and spread to form networks (2D model), or degraded and invaded into the gel (3D). These were observed under an inverted microscope and photographed live. The experiments were performed in duplicates and repeated in independent conditions.

Chromatin Immunoprecipitation (ChIP):In brief,after crosslinking with formaldehyde, DNA from C272/hTert/E7 cells treated or not with TGF-was immunoprecipitated with SMAD4 orpSMAD3 antibodies. Bound DNA was purified and PCR amplified with primers flanking the -191 to -840 TG2 promoter regions. Ten putative SBEs had been identified within this region by bioinfomatics. As the exact SBE was not known, 4 pairs of primers, each encompassing 200bp domains were designed to cover this region. PCR withATCTCCACAGCCCTGTCTTG (F), and GCAGCACCCTCATAGAAAC (R) primers covering the -269 to -479 promoter fragments yielded a positive signal, indicating that the SMAD complex bound to this region. Chromatin immunoprecipitated with SMAD4 or with pSMAD3 antibody was amplified with primers designed for an upstream region (800-1000): TGCCATGTGTTAGGAGCACAAG(F), ATGCCTAGAATCCCAGCGTTAGAG(R), as the negative control. Another negative control was DNA immunoprecipitated with IgG and subjected to PCR amplification. For real time quantitative PCR detection of bound DNA, SYBR-Green master mix was used on an ABI Prism 7900 platform. Percentage of amplification from immunoprecipitated chromatin relative to non-immunoprecipiated (input) chromatin was calculated. For negative control, chromatin immunoprecipitated with normal mouse IgGwas amplified with primers specific for TG2 promoter region. For positive control, chromatin immunoprecipitated with anti-RNA polymerase II was amplified with primers specific for human GAPDH.

Immunohistochemistry: Immunostaining for TG2 was carried out as previously described (Satpathy et al 2007). The antibody for pSMAD3 (Abcam) was used, at a dilution of 1:50 overnight followed by the avidin-biotin peroxidase technique with DAKO Detection Kit(DAKO, Hamburg, Germany). Scoring used a 0-3+ scale for intensity and the percentage of cells staining was quantified. An H score was calculated as the product between intensity and percentage of cells staining and tumors were classified as positive or negative if H score was or < median score, respectively.

Supplementary Figure Legends:

Supplementary Figure 1:TGF-1 effects on TG2 expression; A, Western blotting for TG2 and GAPDH in different OC cell lines. B,Left,Western blotting for TG2 and GAPDH in OC cells (Hey and IGROV-1) treated with 5ng/mL TGF-1 for 24 and 48 hours. Right,Western blotting for TGF- receptors I, II, SMAD2/3, SMAD 7, TAK1, and GAPDH in OC cell lines, NOSE cells, and mesothelial LP9 cells. C, Effects of a neutralizing TGF- antibody (5g/mL) on TG2 induction by TGF- (Q-PCR, p < 0.01). D, Western blotting for TG2 and GAPDH in SKOV3 cells plated on fibronectin (5g/mL, left panel) coated plates or plastic (right panel). E, Dose response to TGF-1 in C272hTert/E7 (0.5ng/mL-10ng/mL) and SKOV3 cells (2ng/mL-15ng/L). Densitometry quantifies the level of expression of TG2 relative to GAPDH.

Supplementary Figure 2:TGF-1 effects on TG2 activity; TGase assay was performed to detect TG2-catalyzed amine incorporation into proteins. Left panels: Napthol blue staining demonstrates equal loading of proteins per lane. Right panels: immunoblotting with HRP-conjugated streptavidin illustrates biotin-conjugated amine incorporation into proteins, as described in Materials and methods. Hey cells, primary ovarian cancer cells(OVCA#16), mesothelial cells (LP9) and normal ovarian epithelial cell NOSE#1001 were treated with TGF-β1, and incubated with BPA to detect TG2 activity in the presence or absence of Ca++. Arrows point to protein ladder formed when active TG2 catalyzes amine incorporation into proteins.

Supplementary Figure 3: A, ChIP assay demonstrates the binding of pSMAD3 (upper) and of SMAD 4 (lower) to the TG2 promoter. Crosslinked chromatin from C272/hTert/E7 cells treated with TGF-β1 or vehicle was immunoprecipitated with SMAD4 or pSMAD3 antibody and amplified by PCR. A 210bp PCR product was detected by agarose electrophoresis. B, Western blotting for E-cadherin, N-cadherin, and GAPDH in SKOV3-ASTG2 and control cells treated with TGF-β1 or vehicle (right top). C, Morphological changes in SKOV3-ASTG2 and control cells treated with vehicle or TGF-β1 for 48 hours (100X magnification, lower panels).

Supplementary Figure 4: A) Flow cytometry quantifies CD44+/CD117+ cells in IGROV1 cells treated with TGF-1 for 24 hours. B)Flow cytometry quantifies CD44+/CD117+ cells in SKOV3 cells transfected with AS-TG2 and control and treated with TGF-1 for 24 hours.

Supplementary Figure 1

Supplementary Figure 2

Supplementary Figure 3

Supplementary Figure 4