Supplementary 1: Description of primers (synthesized from Sigma, USA) used in the analysis.

Primer Sequence (5’→3’) * / Ampli-con / Remark
PG1F: TTTCCCCATGGCTTTATGTTCATAGTGC (NcoI)
PG2R: ATAGTAGATCTTGGGTCCGCAAGAGA (BglII) / 2581bp / The letters underlined are the restriction enzyme recognition sites incorporated. Used for cloning of class I chitinase gene (AF153195) from Solanum tuberosum and for checking transgene incorporation by PCR and colony PCR
ChvA_F: GGCGTCTTTAATACCGTCGCTTA
ChvA_R: GAATCAGGGTCGTAGACACGTTG / 971bp / Designed from the attachment protein (chvA) gene of A. tumefaciens and was used to detect the bacterial contamination of putatively transformed secondary embryos
HPT_F:
ATGCCTCCGCTCGAAGTAG
HPT_R:
ATTTCGGCTCCAACAATGTC / 167bp / Used to check the presence of hptgene by colony PCR of recombinant A. tumefaciens LBA4404 (pCAMBIA 1301-Chi)
AbC_F:
TCTGGTGGAGACATAGGC
AbC_R:
CACCAGTAGTGCCAAAGC / 157bp / Used for determining transgene copy number by absolute quantification by real time PCR
RCH_F: AAACTACTGGAGGATGGGCTTCAG
RCH_R: TAAAAGGTCCACTTCGATGGCTCT / 212bp / Used for studying transgene expression analysis of relative quantification by real time PCR
18S _F:
GGCCGGCTCCGTTACTTTG
18S_R:
GTTTCAGCCTTGCGACCATACTC / 401bp / Housekeeping gene (18S rRNA, GenBank: AY563528) primer for analysis of relative quantification by real time PCR
CAT_F:
AGCGTGCGGTTTGCATGA
CAT_R:
GCCCAAAGGTTTGGCATCA / 315bp / Housekeeping gene (Camellia tubulin, GenBank: DQ444294) primer for analysis of relative quantification by real time PCR

*F and R indicate forward and reverse primers, respectiv

Supplementary 2: Description of germplasms, collected from New Botanical Area, Tocklai Tea Research Institute, TRA, Jorhat, considered for the present study [Source: Field Management in Tea (Darjeeling 2008). Tea Research Association].

Germplasm / Herbarium Accession No. / Category / Salient Features
AV2(Balai) / 3932 / Standard / It is China hybrid cultivar, fairly hardy. Yield and quality potentials are above average. Fairly resistant to mite and blister blight. It performs well at all elevations. However, size of the leaves reduces at high elevation.
Bannockburn 157 (B157) / 3951 / Quality / It is an early flushing China hybrid cultivar having similarity to domesticated Camellia. It produces the most important flavor of Darjeeling. The yield potentiality is above average. Strongly resistant to drought and red spider but susceptible to blister blight
Tukdah 78 (T78) / 3938 / Standard / Vigorous China hybrid cultivar, dark green erect leaf, easy rooter. Yield potentiality is high, flavor, briskness are above average. Resistant to drought, fairly resistant to blister blight and susceptible to red spider.
Tukdah 383 (T383) / 3946 / Standard / A China hybrid cultivar with semi-erect, dark green leaves. Rooting is good, yield and quality potentials above average. Fairly resistant to blister blight, drought and red spider.

Supplementary 3: Confirmation of PCR amplification specifities of real time PCR products with the help of melting curve (a) and melting peak (b) analysis with the standard dilutions and the unknown putative transformants as templates.