Preparation of Total RNA from Brain Tissue

Materials and Methods

Preparation of Total RNA from Brain Tissue

Total RNA was isolated from the ipsilateral cortical punch biopsy using the RNeasy 1 kit (Qiagen). The quality of the RNA was assessed by spectroscopy, A260/280 ratio in Tris-EDTA (pH 8.0) and ranged between 1.8 and 2.1. Agarose gels (1%) were run to verify that RNA was not degenerated.

cDNA Synthesis, Transcription, RNA Purification, and Concentration

First-strand synthesis of cDNA was achieved using the Eberwine method (Van Gelder et al., 1990). Briefly, total RNA (3 µg) was reverse transcribed to cDNA using a T7 promoter tagged anchored PolyT primer. Subsequently, second-strand synthesis was achieved using DNA polymerase I (40 U; Promega, Madison, WI), DNA ligase (10 U; Invitrogen, Carlsbad, CA), RNase H (2 U; Invitrogen), dNTP (10 mmol/L each) and 10x DNA polymerase I buffer with an incubation at 16°C for 2 h. The double-stranded cDNA sample was then used as a template in an in vitro transcription reaction using a T7 Megascript kit (Ambion, Austin, TX) following the protocol supplied and then purified using an RNeasy column (Qiagen, Doncaster, Victoria, Australia). The sample was dry- eluted to 12 µl using a vacuum centrifuge and quantified using a spectrophotometer.

Probe Preparation and Hybridization

Amplified RNA (4–10 µg) was indirectly labeled by incorporation of amino allyl dUTP (Sigma, Sydney, Australia) during reverse transcription. The sample was then purified using the Qiagen QIAquick Purification kit following the protocol provided with the exception that the sample was not eluted but left on the column for the subsequent coupling step.

Cyanine-5 fluorophor (Amersham, Castle Hill, NSW, Australia) was resuspended in 20 µl of 0.1 mol/L Na bicarbonate buffer and added to the center of the column above for all of the test samples. Cyanine-3 fluorophor was used for a reference sample, which consists of pooled and amplified RNA from day 17 C57/B6 fetus. A 1-hour incubation of the column (in the dark) was then required. The sample was then eluted with 80 µl of water and 13,000 rpm for 1 minute. Five volumes of buffer PB (Qiagen QIAquick kit) were added to each sample.

The eluted cyanine-3-coupled reference sample was added to a new Qiagen column, the eluate was discarded, and then the cyanine-5-coupled test sample was applied to the same column. It was washed with PE buffer, and the sample was eluted with EB buffer (Qiagen). A hybridization mix consisting of tRNA, cot-1 DNA, PolydA, and 50x Denharts containing herring sperm DNA was added to the eluted sample, and the sample concentrated in a centrifugal evaporator. Standard saline citrate (20 x SSC) and 100% deionized formamide were added and the sample denatured at 100°C for 3 minutes. Sodium dodecyl sulfate (10%) was then added, and the samples applied to the slide and hybridized for 14 to 16 h in a humidified chamber at 42°C. The slides were then placed in 0.5x SSC and 0.01% sodium dodecyl sulfate until the coverslips came off and then incubated a further 1 minute in the same solution. The next wash was in 0.5% SSC for 3 minutes, and the final wash was in 0.06% SSC for 3 minutes. The slides were centrifuged dry at 800 rpm for 5 minutes.

Real-time quantitative PCR (rt-PCR)

Validation of genes from microarray analysis was performed using Lightcyclerä technology (Roche). Samples used for validation were those generated in a co-hort of animals independent the microarray analysis. With this technique, levels of PCR product are quantitatively determined though the amount of fluorescence generated by the incorporation of the SYBRä green I dye (Roche). Initial optimisation of PCR conditions including annealing temperature, MgCl2 concentration and primer concentration was performed on a standard block cycler as previously described. These conditions were transferred to the Lightcycler with MgCl2 optimisation repeated. rt-PCR reactions were performed in 10mL reactions in Lightcycler capillaries (Roche) that contained 2mL of cDNA, MgCl2 (concentration range of 2-5mM), 0.5mM 5’ primer, 0.5mM 3’ primer, 1mL SYBRä Green I (Roche) and sterile MQ-water. A negative control was also set up (containing no cDNA template). At the optimal MgCl2 concentration, a run was performed to optimise template concentration (ranging from 1:2 to 1:40 dilution). Each run contained 4 standards (ranging from 200pg to 0.2pg) of both the gene of interest and also 18S internal standard (Ambion). A reaction was set up for both the gene of interest and 18S for each sample with expression levels determined though a direct comparison to the appropriate standard. Levels of expression of the gene of interest were corrected for the corresponding levels of 18S in that sample.

Primer design

Sequences for genes to be validated were extracted from NCBI http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Nucleotide and inserted into Primer 3 http://www-genome.wi.mit.edu/cgi-bin/primer/primer3_www.cgi/ for primer design based on a criteria that included Tm values between 58-60°C, a length of 20mer, a product size of 150-300bp, with an absence of long G-C stretches. The chosen primers were then placed into Blast http://www.ncbi.nlm.nih.gov/BLAST/ to ensure sequence specificity (Table 1).

Table 1. Primer sequences used for quantitative real time PCR.

Candidate Gene / Accession number / 5’ primer / 3’primer
Caspase 8 / NM_009812 / CCTAGACTGCAACCGAGAGG / GCAGGCTCAAGTCATCTTCC
Cd14 / NM_009841 / TCCGAAGCCTTCCAGTGTGT / ACAGAGAGCCGCCATCAGTC
cFos / NM_010234 / CTCCCGTGGTCACCTGTACT / TTGCCTTCTCTGACTGCTCA
Gadd 45 / NM_011817 / TCGCACAATGACTCTGGAAG / CAGGGTCCACATTCAGGACT
IL1-b / NM_008361 / GCCCATCCTCTGTGACTCAT / AGGCCACAGGTATTTTGTCG
IL-6 / NM_031168 / TGTTCTCAGGGAGATCTTGGAAA / CAGAATTGCCATTGCACAACTC
Myc / NM_010849 / GCCCAGTGAGGATATCTGGA / ATCGCAGATGAAGCTCTGGT
S100a6 / NM_011313 / ggaaatcaccatgccctcta / gagatgccacacccactttt
Socs 3 / NM_007707 / CCTTTGACAAGCGGACTCTC / GCCAGCATAAAAACCCTTCA
Stat 3 / NM_011486 / CTTGGGCATCAATCCTGTGG / TGCTGCTTGGTGTATGGCTCTAC
18s rRNA / NR_003278 / CTTAGTTGGTGGAGCGATTTGTC / AGAGTCTCGTTCGTTATCGGAATT

Figure 1A. Independent validation of selected genes using Real-time PCR. A. Total RNA was extracted from brains after TBI and TBI + Minocycline and cDNA synthesised. The expression of the selected genes was determined using specific primers (Table 1) with 18S included as an internal standard. Data represents the mean ± SEM of n=3.

Figure 1B. Independent validation of selected genes using Real-time PCR. Total RNA was extracted from brains after either saline injection or Minocycline treatment only and cDNA synthesised. The expression of the selected genes was determined using specific primers (Table 1) with 18S included as an internal standard. Data represents the mean ± SEM of n=3.

Figure 1A

Figure 1B