Supplementaryinformation
Physiological investigation
Motor nerve conduction studies: for the mother AJG82,median nerve (at elbow): 56.2 m/s, peroneal nerve: at fibular head 52.3 m/s, at the knee 62.1 m/s, tibial nerve (at the knee) 46.1 m/s, low CMAP amplitudes and normal conduction velocities; for AFB2, median nerve (proximal): 20.5 m/s, peroneal nerve at the fibular head: 20.0 m/s, tibial nerve (at the knee) 14.7 m/s, low CMAP amplitudes and low normal conduction velocities; for AFB3, ulnar nerve R (at wrist) 28.0 m/s, tibial nerve R (at knee) 11.0 m/s, very low CMAP amplitudes (ulnar nerve 27.0%, tibial nerve 5.2%, peroneal nerve 23.5%), exceptionally high voltage required; for AFB4, peroneal nerve proximal motor latency 15.6, conduction 7 m/s, median nerve: distal motor latency 3.8, amplitude 0.283 mV, proximal motor latency 13.6, conduction 6 m/s. Needle EMG investigation: for AGJ82, abnormal activity of muscle fibers at rest; for AFB2, no spontaneous activity of muscle fibers at rest; for AFB4, massive spontaneous activity of muscle fibers at rest with no voluntary movements and positive waves suggesting denervation. Muscle biopsy analysis revealed the presence of centralized nuclei for AGJ82 and AFB2 but not for AFB4. Altogether, these features are suggestive of centronuclear myopathy for AGJ82, centronuclear myopathy or lower motor neuron disease for AFB2, demyelinating Charcot-Marie-Tooth disease or Spinal muscular atrophy (SMA) for AFB3 and anterior horn disease or SMA for AFB4.
METHODS
Muscle biopsy preparation and staining
Muscle biopsies were obtained from AFB2, AFB4 (quadriceps) and their mother AGJ82 (tibialis anterior). The AFB4 biopsy was obtained post-mortem.The AFB4 and AFB2 biopsies were analyzed with Hematoxin-eosin staining. Ten µm sections were incubated for 1 h with R2641, rabbit in house polyclonal [OK1]antibodies against dynamin 2,1 then 45 min with secondary antibodies (AlexaFluor 488 goat anti-rabbit, Invitrogen). Fluorescence was examined with a Leica SP2-AOBS confocal microscope (Leica Microsystems). Pictures were processed with the Tcstk and Dvrtk software (Jean-Luc Vonesch, Imaging Center, IGBMC) and Photoshop 7.0 (Adobe).
Cell culture
Control (3 unrelated cell lines) and patient (AFB2 with the homozygous F379Vp.Phe379Val mutation) fibroblasts were grown in Dulbecco’s modified medium (DMEM) supplemented with 10% (v/v) fetal calf serum (FCS) at 37°C in a humidified incubator, 5% CO2. Protein concentrations were determined as per standard techniques and 30 µg of each sample were resuspended in Laemnm[OK2]li loading dye and analyzed by Tris-Glycine SDS-PAGE and western blot analysis. Antibodies employed included GAPDH (Millipore), and in house R2680 rabbit polyclonalanti[OK3]-dynamin 2 antibodies.1
Transferrin uptake
Serum-deprived fibroblasts were incubated with AlexaFluor 633 conjugated transferrin (Invitrogen) for 15 min. Cells were washed twice for 3 min in 0.2 M acetic acid, 0.5 M NaCl followed by washing in 0.25 M Tris (pH 10) for 2 min and were subsequently fixed in 1% (v/v) formaldehyde. To block dynamin action, cells were treated with dynasore[OK4], a small non-competitive inhibitor of dynamin by acting on its GTPase domain (Sigma Aldrich).2 The samples were analyzed on the FACSCalibur (BD Biosciences) employing the Cell Quest Pro program (BD Biosciences). Subsequent analysis was performed employing the Flowjo software (Tree Star Inc., Oregon, USA). The student’s t test was used for statistical analysis. P values of <0.01 were considered significant.
Dynamin 2 in vitro experiments
Cloning, expression and purification: The cloning of the wild-type human dynamin 2 (isoform 1; Accession number NM_001005360) into pENTR1A has been reported elsewhere.3 Human dynamin 2 mutant (p.Phe379Val) was generated by primer directed PCR mutagenesis from the wild type construct using primers 5’ CTGGTAAAGATGGAGGTTGACGAGAAGGAC 3’ and 5’ GTCCTTCTCGTCAACCTCCATCTTTACCAG 3’. The pDEST8 (Invitrogen) expression constructs were generated by homologous recombination. WT and mutant (p.Phe379Val) human DNM2 were expressed in SF9 insect cells and purified against GST-SH3 (Amphiphysin I; a kind gift from P. De Camilli[OK5]). Purified dynamin 2 proteins were stored in 20 mM HEPES-KOH pH 7.4, 300 mM NaCl, 1 mM DTT, 1 mM EGTA, 30% (v/v) glycerol, snap frozen and stored at -80°C. GTPAse assays to measure dynamin’s basal activity were performed in 20 mM HEPES-KOH 7.4, 100 mM NaCl, 1 mM MgCl2 using the Malachite green method in the presence of 0.5 mM GTP. 4EM tubulation assays: 2-5 µL of GTPase buffer (20 mM HEPES pH 7.4, 100 mM NaCl, 1mM MgCl2) were deposited on parafilm to form a water droplet. PPurified[OK6] dynamin 2 protein solution (2-5 µl of a 0.5-2 mg/ml solution) were then added to the droplet, and the reaction was initiated by adding 0.5-1µL of liposomes composed of 85 % (m/m) phospholipids [30% brainphosphatidylethanolamine (PE), 5% liver phosphoinositides (PI), 30% palmitoyl-oleylphosphatidylserine (POPS) and 35% palmitoyl-oleyl phosphatidylcholine (POPC)], and 15%(m/m) cholesterol; Avanti Polar Lipids Inc., USA prepared using the spontaneous growth method.5 After 5 min incubation at room temperature, a carbonized EM grid was deposited on the top of the droplet for 1 min. The grid was then washed in a 50 µL droplet of GTPase buffer, blotted against filter paper, and stained by depositing the grid onto a 10 µL Uranyl Acetate 2% droplet for 30 sec. Grids were then dried with filter paper, and directly analyzed with a FEI Tecnai G2 Sphera microscope.
In situ hybridization
In situ hybridization assays on mouse embryos sections were performed, employing the Dnm2 mRNA probe (obtained from Eurexpress, as previously described.6Controls (lacking mRNA probe) were performed in parallel to monitor levels of non-specific binding.[OK7]
Injection of morpholinos into zebrafish embryos
A translation blocking morpholino (5’ ATTCCTCCATCCCCCGGTTGCCCAT 3’) against the Danio reriodnm2 mRNA was designed and purchased from Gene Tools (Oregon, USA). Wild-type (AB) and transgenic Tg(flk1:eGFP) zebrafish were used. dnm2 MO (4 or 5 ng) was injected into one cell stage embryos. Anti-acetylated tubulin labeling in zebrafish was performed as previously described.7
Imaging and data processing
Live zebrafish embryos were anesthetized in Tricaine solution and mounted in low melting point agarose gel. The excitation light was provided by a mode-locked Ti: Sapphire laser (Chameleon Ultra, Coherent Inc., USA) that delivers 150 fs pulses with 80 MHz repetition rate. The excitation beam was focused on the sample by 20x 0.95 N.A. water immersion objective (Leica Microsystems). The excitation wavelength was 900 nm for second harmonic generation. The second harmonic and fluorescence signals were collected in trans and epi configuration respectively. The data visualization was performed using ImageJ and Imaris software (Bitplane).
REFERENCES
1.Cowling BS, Toussaint A, Amoasii L et al: Increased expression of wild-type or a centronuclear myopathy mutant of dynamin 2 in skeletal muscle of adult mice leads to structural defects and muscle weakness. Am J Pathol 2011; 178: 2224-2235.
2.Macia E, Ehrlich M, Massol R, Boucrot E, Brunner C, Kirchhausen T: Dynasore, a cell-permeable inhibitor of dynamin. Dev Cell 2006; 10: 839-850.
3.Nicot AS, Toussaint A, Tosch V et al: Mutations in amphiphysin 2 (BIN1) disrupt interaction with dynamin 2 and cause autosomal recessive centronuclear myopathy. Nat Genet 2007; 39: 1134-1139.
4.Leonard M, Song BD, Ramachandran R, Schmid SL: Robust colorimetric assays for dynamin's basal and stimulated GTPase activities. Methods Enzymol 2005; 404: 490-503.
5.Takei K, Haucke V, Slepnev V et al: Generation of coated intermediates of clathrin-mediated endocytosis on protein-free liposomes. Cell 1998; 94: 131-141.
6.Schaeren-Wiemers N, Gerfin-Moser A: A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: in situ hybridization using digoxigenin-labelled cRNA probes. Histochemistry 1993; 100: 431-440.
7.Colantonio JR, Vermot J, Wu D et al: The dynein regulatory complex is required for ciliary motility and otolith biogenesis in the inner ear. Nature 2009; 457: 205-209.
FIGURE LEGENDS
Supplementary Figure 1.Clinical characterization of patients. Anteroposterior radiograph of the right arm of AFB3 shows slender bones of humerus, radius and ulna with normal bone density. Anteroposterior radiograph of the thorax and abdomen of AFB3 depicting thin ribs with normal length and bone density. Note the deep position of the endotracheal tube. Anteroposterior view of the right arm shows slender bones of humerus, radius and ulna with normal bone density.
Supplementary Figure 2. Homozygosity by descent for the five children employing a 250 K Affymetrix Mapping array. Homozygous regions are depicted in dark blue over the whole chromosome 19. The largest common region of homozygosity for the three affected children (indicated by a red box) was found on chromosome band 19p13, from 8483868 to 12350726 (hg18 release) and contained 141 genes including the DNM2 gene.
Supplementary Figure 23.Analysis of a muscle biopsy from a heterozygous carrier.(a) Hematoxin-eosin staining of right tibialis anterior muscle biopsy of the AGJ82 heterozygous mother (left: 10x magnification, right: 40x magnification). Heterogeneous fibers size with hypertrophic and hypotrophic fibers and a high proportion of central nuclei are observed, typical for DNM2-related autosomal dominant centronuclear myopathy. Scale bar represents 50 µm.(b) The presence of the F379Vp.Phe379Val mutation at the heterozygous state does not affect dynamin 2 localization in muscle. Immunostaining of longitudinal sections of control (46 years old) and AGJ82 muscle biopsies with anti-dynamin 2 R2641 specific antibodies. Scale bar represents 10 µm.
Supplementary Figure 34. Impact of the F379Vp.Phe379Val on cellular processes involving DNM2 action. (a) The F379Vp.Phe379Val mutation does not affect centrosome cohesion as revealed by staining control and F379Vp.Phe379Val fibroblasts with γ tubulin antibodies; centrosome cohesion was perturbed in 2%+/-1% of control cells versus 3%+/-1% for F379Vp.Phe379Val cells. (b) The F379Vp.Phe379Val mutation does not cause trans or cis-Golgi network fragmentation. Trans and cis-Golgi network morphology was compared in control and patient fibroblasts by immunofluorescence using anti-golgin 97 and GM130 antibodies. Nocodazole treatment resulted in fragmentation of the network in both instances. Nuclei were stained with Hoechst. Scale bars represent 10 µm.
Supplementary Figure 45.Dnm2 morphant morphology. Dnm2 morphant phenotype at 48 hpf (hours post-fertilization) (a-c) and at 72 hpf (d, e). Dnm2 morphants display variable phenotypes and severe tail truncation can be seen in a small fraction (10%, n=300) of injected embryos (c). These embryos were discarded and further analysis was performed at 72 hpf using non-truncated embryos (70%, n=300) (d, e).
Supplementary Figure 6. Morphology of nerves in the tail of control and dnm2 MO-injected. Peripheral nerves detected with anti-acetylated tubulin immunofluorescence (Ac. Tub.) appear similar in control and dnm2 MO embryos.
1
[OK1]Change #17
[OK2]Change #18
[OK3]Change #14
[OK4]Change #19
[OK5]Change #2
[OK6]Change #20
[OK7]Change #15