ON LINE MATERIALS AND METHODS
Cell cultures. UM-UC-3 (human bladder epithelial cell line) and VERO (kidney epithelial cells extracted from an African green monkey) were maintained in DMEM (Dulbecco's Modified Eagle Medium) medium with 10% heat-inactivated fetal bovine serum (FBSi), 2mM L-Glutamine and 1x antibiotics. tUEC transformed human urethral epithelial cells were maintained in PrEBM medium supplemented with the SingleQuot Kit (Lonza). HeLa human epithelial cervical cancer cells were maintained in DMEM (high glucose) with 10% FBSi and 1x antibiotics. CHO (Chinese Hamster Ovary) cells were maintained in F-12 Nutrient Mixture (Ham) supplemented with 10% FBSi, 5% L-glutamine and 1x antibiotics. All the cell lines were incubated at 37°C in 5% CO2 (v/v).
PCR amplification of fdeC gene. ThefdeC gene was amplified using internal primers (fdeC-F GGTGAGGCAACGATTACTGTTAG, fdeC-R GTATTCCCCGTCTTGCTGGTC), designed in conserved nucleotide regions. PCR was carried out with GoTaq®PCR Master Mix as specified by the manufacturer (Promega), with 30 cycles of amplification steps of 30 s at 94°C, 30 s at 55°C, and 1 min at 72°C and a final elongation step at 72°C for 7 minusing 100ng of chromosomal DNA as template. Amplified products were examined on a 1% agarose gel stained with SYBR® Safe DNA gel stain (Invitrogen).
Construction of deletion mutant strains. The isogenic mutant strains were constructed by replacement of the entire gene by an antibiotic cassette. The upstream and the downstream regions of the fdeC gene were amplified by PCR using IHE3034 chromosomal DNA as template and cloned into pBluescriptKS (Stratagene). The kanamycin cassette was inserted between the two flanking regions into the plasmid. The resulting fragment was used to electroporate the target strain. Single transformants were confirmed by PCR.
Recombinant protein purification. To purify the His-tag fusion protein, the recombinant BL21(λDE3) clone was inoculated into 20 ml of LB broth containing 100μg/ml ampicillin and grown overnight at 37°C. Bacteria were diluted 1:20 into 1000 ml of fresh medium and grown at 37°C until OD600 reached 0.6-0.8. Gene expression was induced with 1.0 mM isopropyl-D-thiogalatoside (Sigma) for 3h at 37°C. The resulting biomass was used to purify the protein. The bacterial pellet was resuspended in cold buffer A (300 mM NaCl, 50 mM phosphate buffer, 30 mM imidazole, pH 8.0). Cells were disrupted by sonication and centrifuged at 38,000xg for 30 min at 4°C. The supernatant was purified by affinity chromatography using a nickel chelating resin (GE supplied) and buffer B (300 mM NaCl, 50 mM phosphate buffer, 250 mM imidazole, pH 8.0). The protein was eluted in a linear gradient (0% of buffer B – 100% of buffer B in 20 CV). The protein eluted at the beginning of the linear gradient around 50mM imidazole.
Immunogold electron microscopy. E. coli strain W3110 was cultured to exponential phase and washed in PBS. Formvar-carbon-coated nickel grids were floated on drops of E. coli suspensions for 5 min. The grids were first fixed in 2% PFA for 5 min, and placed in blocking solution containing 1% normal rabbit serum and 1% BSA for 30 min. They were subsequently floated on drops of dilutions of primary antiserum against the FdeC protein for 30 min at RT, washed with six drops of blocking solution, and floated on secondary antibody conjugated to 10-nm gold particles diluted 1:20 in 1% BSA for 30 min. The grids were examined using a TEM GEOL 1200EX II transmission electron microscope at a minimal magnification of 15000x.
Confocal staining of E. coli bacterial cells. E. coli K12 strains were grown to exponential phase in LB medium and fixed in PFA 1% for 20 min on a poly-L-lysine-coated slide (Thermo scientific). After the blocking step in PBS+1% BSA, slides were incubated with a rabbit anti-FdeC serum and then with a donkey anti-rabbit IgG Rhodamine RedX-conjugated antibody (Jackson ImmunoResearch Laboratories). The samples were mounted using the ProLong Gold antifade reagent containing the blue-fluorescent nuclear counterstain DAPI (Invitrogen).
Association assay. Confluent UM-UC-3 monolayers were washed three times with infection medium (basal medium without antibiotics). Bacteria from exponential phase in LB were washed in Dulbecco's complete phosphate-buffered saline (Invitrogen) and adjusted in infection medium to obtain a m.o.i. of 10:1. At the end of a 3h infection, unassociated bacteria were washed away. After 1% saponin treatment, serial dilutions were plated on LB agar plates to determine total associated bacteria (percentage of recovered CFU versus total CFU present).
ELISA assay. 96-well MICROLON 200, flat-bottom plates (Greiner Bio-One) were coated and incubated overnight at 4°C with 1 µg/well of respective ECM collagen I and collagen III (from human lung, Sigma), collagen IV and collagen V (from human placenta, Sigma), collagen VI (from human placenta, BD Biosciences), fibrinogen (from human plasma, Sigma), laminin (from human placenta, Sigma) and fibronectin (from human plasma, Sigma) in phosphate-buffered saline pH 7.4 (PBS). A BSA coated plate served as negative control. The plates were washed (PBS 0.5x, 0.05%Tween) and then blocked by adding 250µl of polyvinylpyrrolidone (PVP) 2.7% for 2h at 37ºC. Wells were washed and the plates were stored overnight at 4°C. The protein solution was serially diluted 2-fold with PBS and transferred into coated blocked plates. Plates were incubated 2h at 37°C. The plates were washed and incubated with for 1h 30 min at 37°C with respective primary rabbit anti-FdeC antibodies (1/1000 dilutions). Wells were washed and incubated for 1h 30 min at 37°C with the antibody (conjugated-HRP, 1:2000). The wells were washed and 100µl of HRP substrate solution was added to the wells. The reaction was stopped after 10min by adding 100µl of 12.5% H2SO4. Read out was performed at 490 nm by an ELISA plate reader.
Quantitative crystal violet staining. The E. coli K12 strains were grown overnight in LB medium and resuspended in sterile polystyrene tubes (BD Falcon) at OD600 0.05. Cultures were incubated at room temperature without shaking for various times. At the desired end-point, non-adherent cells were removed by rinsing with distilled water. Aggregates were stained by the addition of 1% crystal violet (Sigma). The stain was removed by exhaustive washing with distilled water. The tubes were then allowed to dry. In order to quantify the adherent cells, the decolouring solution (ethanol/acetone 80:20) was added to each tube for 15 min. The absorption of the eluted stain was measured at 590 nm.
Murine co-challenge model of ascending UTI. Six- to eight-week-old female CBA/J mice were inoculated transurethrally with a 1:1 ratio of E. coli 536 and fdeC kanamycin-resistant mutant. Input CFU/ml was determined by plating serial dilutions of the inoculum onto LB agar with and without antibiotic. Organs were harvested from euthanized animals at 48 h post-inoculation and homogenized in PBS in the presence of 0.1% saponin. Significant differences in colonization (*) are indicated as the P-values <0.05 (Fig. 6C). Bacteria in tissue homogenates were enumerated by plating on LB agar with and without kanamycin. The wild-type CFU were determined by subtracting the CFU on kanamycin (mutant CFU) from the total CFU recovered on LB without antibiotics. The competitive indices (CI) were determined by dividing the ratio of CFU/g mutant to wild-type by the mutant to wild-type ratio of CFU from the mixed inoculum. Detergent-treated samples were prepared by mixing tissue homogenates in 0.1% saponin. CI values were log-transformed and analyzed by the Wilcoxon signed-rank test to determine statistically significant differences in colonization (P-value < 0.05). A CI > 1 indicates the mutant out-competes the wild-type strain and a CI < 1 indicates a fitness defect.