Supplemental Data

Evolution of Chlamydia trachomatis Diversity Occurs by Widespread Interstrain Recombination Involving Hotspots

João P. Gomes, William J. Bruno, Alexandra Nunes, Nicole Santos, Carlos Florindo, Maria J. Borrego and Deborah Dean

Figure Legends

Supplemental Figure 1(A-H). Phylogenetic reconstructions. Phylogenetic reconstructions of the nucleotide sequences showing the evolutionary history of (A) CT049, (B) CT166,(C) rs2, (D) rs2/ompA IGR, (E) ompA, (F) ompA/pbpB IGR, (G) yfh0_1, and (H) yfh0_1/parB IGR. Amino acid tress were similar to those based on nt data (data not shown). Reconstructions are based on the respective genomic sequences of the reference strains of C. trachomatis. Branch lengths are proportional to distances between strains. The values at the nodes are the bootstrap confidence levels representing the percentage of 1,000 bootstrap resamplings by which the strain to the right was separated from the others.Lineages are color-coded based on the CT049 tree.

Supplemental Figure 2. Ratio of dN and dS mutation substitutions for all C. trachomatis reference strain sequences for CT049, CT166, rs2, ompA, and yfh0_1. Upper and middle graphs show mean dS and mean dN, respectively. Minimum and maximum values represent lower and upper limits of the 95% CI of the estimate, while values plotted at horizontal bar level represent the mean estimate. The chart below represents the values for the dN/dS ratio for each ORF as well as the associated SE and the 95% CI. Note that dN/dS ratios for the other nine ORFs (pmp genes) involved in this study were already presented in Gomes et al. 2006 (Gomes et al. 2006).

Supplemental Figure 3(A-G). Phylogenetic reconstructions. Phylogenetic reconstructions of the nucleotide sequences showing the evolutionary history of (A) CT049, (B) pmpC, (C) rs2, (D) rs2/ompA IGR, (E) ompA, (F) ompA/pbpB IGR, and (G) pmpF. Amino acid tress were similar to those based on nt data (data not shown). Reconstructions are based on the respective genomic sequences of the reference strains and on the 10 clinical isolates of C. trachomatis. Branch lengths are proportional to distances between strains. The values at the nodes are the bootstrap confidence levels representing the percentage of 1,000 bootstrap resamplings by which the strain to the right was separated from the others. Lineages are color-coded based on the CT049 tree.

Supplemental Figure 4. Ratio of dN and dS mutation substitutions for all C. trachomatis reference strains and clinical isolate sequences for CT049, pmpC, rs2, ompA and pmpF. Upper and middle graphs show mean dS and mean dN, respectively. Minimum and maximum values represent lower and upper limits of the 95% CI of the estimate, while values plotted at horizontal bar level represent the mean estimate. The chart below represents the values for the dN/dS ratio for each ORF, as well as the associated SE and the 95% CI.







Supplemental Table 1. List of open reading frames (ORFs) that encode for mechanisms for DNA modification, repair and recombination identified in C. trachomatis reference strain D/UW-3 (GenBank AE001273).

Protein / Gene / ORF
DNA Modification
methylated-DNA protein-cysteine methyltransferase / ada / 477
A-specific DNA methylase / hemK / 024
transcription-repair coupling helicase / mfd / 748
Holliday junction DNA helicase / ruvA / 501
Holliday junction DNA helicase / ruvB / 040
Holliday junction endodeoxyribonuclease / ruvC / 502
DNA repair protein / radA / 298
uracil-DNA glycosylase / ung / 607
exodeoxyribonuclease VII / xseA / 329
DNA Recombination
recombination ATPase / recA / 650
exodeoxyribonuclease V, beta subunit-superfamily I helicase / recB / 639
exodeoxyribonuclease V, gamma subunit / recC / 640
exodeoxyribonuclease V, alpha subunit-superfamily I helicase / recD / 652
exodeoxyribonuclease V, alpha subunit-superfamily I helicase / recD / 033
ABC superfamily ATPase / recF / 074
DHH superfamily exonuclease / recJ / 447
recombination protein / recR / 240
leucyl aminopeptidase / xerB / 045
integrase/recombinase / xerC / 347
integrase/recombinase / xerD / 864
DNA Mismatch Repair
DNA mismatch repair protein predicted ATPase / mutL / 575
DNA mismatch repair protein ATPase / mutS / 792
A/G-specific adenine glycosylase / mutY / 107
endonuclease III-A/G-specific glycosylase / nth / 697
endonuclease IV-A/G-specific glycosylase / nfo / 625
UVR Exonuclease Repair System
ABC superfamily ATPase / uvrA / 333
superfamily II helicase / uvrB / 586
exonuclease subunit / uvrC / 791
superfamily I helicase / uvrD / 608

Supplemental Table 2. Oligonucleotide primers used for PCR and sequencing.

Gene / Primers / Primer sequence (5´ to 3´) / Gene location / Amplicon
size (bp)
CT049 / CT049-1 a
CT049-2 a / cgggaaatcccatacgcaaatc
cacgccttcgacaccatcaca / (-)331-(-)309 b
(+)86-(+)65 c / 1890
CT049-3 d / attgttcctaccgacttct / 93-112
CT166 / CT166-1 a,d
CT166-2 a,d / CAACGGCAGAGACTTCTACTTCAG
TTGCGCGTACATCAGTTGTCTATT / (-)112-(-)88 b
(+)364-(+)388 c / 2420
CT166-3 d / AGGTCATTAGTGCTTACAAC / 254-274
CT166-4 d / AATATCAATGACGAAACGCG / 937-957
rs2 / rs2-2 a,d
rs2-1 a,d / cgcgcccgtagctcaatggtaga
agcgctgcaccacgttcatcaact / (-)153-(-)130 b
(+)214-(+)190 c / 1216
IGR (rs2/ompA) / rs2-3 a,d
rs2-1 a / aatcttgcggtattgcagta
agcgctgcaccacgttcatcaact / (-)488-(-)468 
(+)214-(+)190 c / 1551
IGR (ompA/pbpB) / pbpB-1 a,d
pbpB-2 a,d / ttccgtcgatcataaggcttggtt
ctgtgcgcccttcagaataatgtc / (-)719-(-)695 f
565-541 / 1284
yfh0_1 and IGR (yfh0_1/parB) / yfh0-1 a,d
yfh0-2 a,d / tcctcgcgggacgctatcta
tccccattacggatctccctaac / (-)278-(-)258 g
(+)311-(+)288 h / 1795

aPrimers designed based on the sequence of strain D (strain UW-3) of each genomic region analyzed; b(-) indicates a region upstream to the start codon; c(+) indicates a region downstream to the stop codon; dPrimers used for automated sequencing; e(-) indicates a region upstream to the start codon of rs2 gene; f(-) indicates a region upstream to the start codon of pbpB gene; g(-) indicates a region upstream to the start codon of yfh0_1 gene; h(+) indicates a region downstream to the stop codon of yfh0_1 gene.

1