Inhibition of the Androgen Receptor Induces a Novel Tumor Promoter, ZBTB46, for Prostate

Inhibition of the androgen receptor induces a novel tumor promoter, ZBTB46, for prostate cancer metastasis

Wei-Yu Chen, Yuan-Chin Tsai, Man Kit Siu, Hsiu-Lien Yeh, Chi-Long Chen, Juan Juan Yin, Jiaoti Huang, Yen-Nien Liu

Supplementary Information

Supplementary Figure Legends

Supplementary Figure S1. Identification of potential substrates of the androgen receptor (AR)-microRNA (miR)-1 axis in the ZBTB family. (A) Correlation analysis of 38 members of the ZBTB family identified in a clinical dataset with the AR (left) and miR-1 (right). The first 10 members in the ranking list were selected for further analysis. Among them, five members in the AR ranking (red) overlapped with the miR-1 ranking (green and blue), and then we searched for potential miR-1-binding sites. Candidates that did not show miR-1-binding sites were labeled green, otherwise blue. Only ZBTB46 contained the miR-1-binding site (blue). (B) A Gene Set Enrichment Analysis (GSEA) using the gene set that was suppressed by androgen with TCGA clinical prostate cancer dataset (n=372). An enrichment analysis was performed, and scores were provided as the association strength to selected ZBTB members with higher expression levels (e.g., ZBTB46_High). The ranking of the candidate genes was based on the normalized enrichment score (NES) and false discovery rate (FDR) q-values. ZBTB46 was ranked first based on these criteria (red).

Supplementary Figure S2. Phylogenetic analysis with ZBTB46 and other androgen receptor (AR) signaling-related ZBTB members. (A) Identification of seven members of the ZBTB family involved in androgen response gene sets. The gene sets were retrieved from the molecular database, GSEA. (B) Phylogenetic analysis using sequence alignment performed with the CLUSTALO program. The protein phylogeny tree consists of the seven AR signaling-related ZBTB proteins from the gene sets and ZBTB46.

Supplementary Figure S3. (A) Relative ZBTB46 mRNA levels in the androgen receptor (AR)-negative PC3 cell line following treatment with either an AR activator (dihydrotestosterone; DHT) or an AR inhibitor (enzalutamide; MDV). (B) GSEA with the gene set1 suppressed by AR signaling. The clinical prostate cancer dataset was grouped based on relative ZBTB46 mRNA levels. Black bar, members of the gene set identified in the ranked list of the clinical dataset. Ranked list metric: correlation levels with ZBTB46. NES, normalized enrichment score, FDR, false discovery rate. (C) Relative ZBTB46 and microRNA (miR)-1 levels in cell lines transiently transfected with different DNA constructs. EV, empty control vector; ZBTB46, ZBTB46-expressing vector; miR1+ZBTB46, co-transfection with miR-1 precursor and ZBTB46 plasmids; con, control vector for miR-1.(D) SNAI1 reporter assay in response to MDV treatment in the LNCaP-AR cell line. Cells were pretreated with siRNA targeting ZBTB46 for knockdown (siZBTB46). NC, no siRNA treatment control; WT, wild-type ZBTB46-binding sequence. (E)Parson correlation between SNAI1 and neuroendocrine marker synaptophysin (SYP) in one clinical dataset.2

Supplementary Materials and Methods

Cells, reagents, and constructs

The non-metastatic LNCaP-AR (parental LNCaP overexpressing wild-type AR) and metastatic RasB1 (DU145 expressing a constitutively active Ras) cell lines were obtained from Dr. Kathleen Kelly (NCI/NIH, Bethesda, MD, USA) and maintained as previously described.3-5 The DU145, PC3, LNCaP, and 22Rv1 cell lines were from ATCC (Manassas, VA, USA). Cells were authenticated within 6 months prior to use according to the provider’s recommendations. All cells were tested for mycoplasma contamination. All cells were cultured in RPMI 1640 media supplemented with 10% fetal bovine serum (FBS). Cells were treated with 10 µM of an AR antagonist, MDV3100 (Selleck, Houston, TX, USA), for 24 h in 10% FBS-containing medium. Dihydrotestosterone (DHT; Sigma-Aldrich, St. Louis, MO, USA) treatment was followed by culturing at 10 nM for 24 h in 10% charcoal-stripped serum (CSS)-containing medium. Small interfering (si)RNAs (scrambled, siAR, siZBTB46, and siSNAI1) were obtained from ON-TARGETplusSMARTpool siRNA (Thermo Scientific Dharmacon, Waltham, MA, USA). Anti-miR inhibitors (NC and anti-miR-1) and miRprecursors (empty vector (EV) and miR-1) were from GeneCopoeia (Rockville, MD, USA). The short hairpin (sh)RNA vectors (LacZ and ZBTB46) were from the RNAi Core Lab (Academia Sinica, Taipei, Taiwan). ZBTB46 and SNAIL complementary (c)DNA-expressing constructs used in this study were cloned into a pcDNA3.1 vector. Transient transfections of plasmids and siRNAs/anti-miR inhibitors were respectively carried out using the X-tremeGENE HP DNA transfection reagent (Roche, Clovis, CA, USA) or LipofectamineRNAiMAX (Invitrogen, Carlsbad, CA, USA). The human ZBTB46 full-length 3' untranslated region (UTR) reporter was constructed using the psiHECKTM-2 vector (Promega, Madison, WI, USA). The ZBTB46-binding site was located upstream of human SNAI1 on chromosome 20: 49982711 at GRCh38. These promoters with response element-green fluorescent protein (GFP) reporter vectors were constructed using the pGreenFire1 Lentivector Kit (System Biosciences, Palo Alto, CA, USA). The miR-binding site and response element mutations were generated using a Site-Directed Mutagenesis System kit (Invitrogen). All experiments using the RasB1 cell line expressing shRNA against ZBTB46 (labeled sh46-1 and sh46-2) and the negative control (shLacZ) were stable cell lines; 2×105 cells/6-well plate was transfected with 5 µg DNA and selected by incubation with puromycin for 1 month. Similarly, stable RasB1 cell lines utilized in the xenograft mouse model expressing ZBTB46 were established by transfection with a ZBTB46 cDNA-encoding or empty pCDH-CMV-MCS-EF1-Puro vector followed by puromycin selection (System Biosciences). A stable cell line expressing both ZBTB46 and miR-1 was enriched by GFP signals expressed by the vector expressing the miR-1 precursor (GeneCopoiaTM) using FACS. All primers used for these constructs are listed in Supplementary Table S1. All constructs were verified by a DNA sequence analysis.

Proliferation assay

Transfection of the ZBTB46 expression vector in DU145 or LNCaP-AR cells was performed at a density of 2000 cells/well. To mimic androgen deprivation treatment (ADT), LNCaP-AR cells were seeded in 96-well plates (5000 cells/well) in charcoal-stripped FBS-containing medium followed by ZBTB46-expressing vector (1 μg) transfection or MDV3100 (10 µM) treatment. Each day, one plate was stained with a 0.5% crystal violet fixative solution for 15 min, rinsed in distilled water, and allowed to air-dry. At the end of the experiment, crystal violet was dissolved by adding 100 μl of 50% ethanol containing 0.1 M sodium citrate to each well, and the absorbance was quantified at a wavelength of OD 550 nm on a plate reader.

Colony formation assay

An in vitro colony formation assay was performed using 5 × 104 cells/well. Single-cell suspensions of ZBTB46 shRNA-transfected RasB1 cells were seeded in 12-well plates in 10% FBS-containing RPMI 1640 medium in triplicate and incubated for 2 days at 37 °C in a humidified incubator. After 2 days, half of the medium was gently aspirated off and replaced with fresh medium. Colonies were counted on day 14 after plating following trypan blue (Invitrogen) staining. To mimic ADT, 1000 cells/well of LNCaP-AR cells were seeded in 12-well plates in charcoal-stripped FBS-containing medium followed by ZBTB46-expressing vector (1 μg) transfection. Colonies were counted at weeks 1 to 3 after plating following trypan blue (Invitrogen) staining.

Migration and invasion assays

For the invasion and migration assays, the ZBTB46 or SNAI1 expression vector and ZBTB46 shRNA/siRNA or SNAI1 siRNA were transfected into LNCaP-AR or RasB1 cells and resuspended at a concentration of 2.5×105 cells/ml in serum-free medium. BD MatrigelTM was purchased from BD Biosciences (San Jose, CA, USA) for the invasion assays. Matrigel-coated transwell dishes were prepared by adding 200 μl of 10-fold serum-free medium-diluted Matrigel. In total, 2.5×105 cells/well in serum-free medium were added above the Matrigel. The lower chamber was filled with 600 μl of serum-containing medium. Cells that had invaded the Matrigel-coated transwells after 12 h were fixed and stained with a 0.5% crystal violet fixative solution for 15 min. Invaded cells on the underside of the membrane were counted and quantified in five medium-power fields for each replicate in triplicate. The migration assay used transwells without Matrigel, and cells were fixed and stained as described for the invasion assay.

Real-time reverse-transcription (RT)-polymerase chain reaction (PCR)

RT-PCR analyses were used to measure AR, ZBTB46, and miR-1 expressions in human prostate cancer cell lines in the presence or absence of DHT or MDV3100 stimulation. In addition, we prepared samples collected from 18 primary prostate tumors (approval no.: N201512066) from Wan Fang Hospital, Taipei Medical University. Total RNA was isolated using a mirVana PARIS RNA isolation system (Ambion, Austin, TX, USA). For RT, 3 µg of total RNA was used with the SuperScript III kit (Invitrogen). The amplification step was performed with SYBR Green PCR master mix (Applied Biosystems, Beverly, MA, USA). For all primer pairs, the thermocycler was run for an initial 95 °C incubation for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All reactions were normalized to human GAPDH and assayed in triplicate. miR RT-PCRs were performed using a TaqMan MicroRNA Assay kit (Applied Biosystems). All values were normalized to the human SNORD48 endogenous control and assessed in triplicate. All primers used for the PCR analyses are listed in Supplementary Table S2.

Western blot analysis

Cells grown on 6-well plates (106 cells/well) were lysed in 150 μl RIPA buffer containing complete protease inhibitors (Roche), phosphatase inhibitors (Roche), 25 mM β‐glycerophosphate, 10 mM sodium fluoride, and 1 mM sodium vanadate. Twenty micrograms of protein was separated per lane by sodiumdodecylsulfate (SDS)-gel electrophoresis. After transfer to polyvinylidene difluoride (PVDF) membranes, blots were blocked with 5% bovine serum albumin (BSA) in PBST (PBS and 0.1% Tween-20). Primary antibodies were incubated overnight at 4 °C, and secondary antibodies were incubated at room temperature for 1 h as indicated in Supplementary Table S3.

Chromatin immunoprecipitation (ChIP) assay

ChIP assays were performed via the EZ magna ChIP A kit (Millipore, Temecula, CA, USA) with a modified protocol as previously described.5,6 Samples were purified through PCR purification kit columns, and 2 µl of eluted chromatin was used as a template in the quantitative (q)PCR. ChIP antibodies and qPCR primers are listed in Supplementary Table S4.

Supplementary Tables

Supplementary Table S1. Primer sequences of the human ZBTB46 3'UTR reporter constructs

Human ZBTB46 3'UTR reporter construct primer sequences
ZBTB46/miR-1 RE 3UTR F / atcgctcgagGAAAAGCAAAGGTCCCACGG
ZBTB46/miR-1 RE 3UTR R / attcgtttaaacAAAACTCTTTCCACGCAGCC
ZBTB46/miR-1M F / AGCACTCACCATGAGGAAAGGAAATCCTTCACC
ZBTB46/miR-1M R / AGTCCGGACGGAGACTGTCGTGAGTGGTACTCC
Human SNAI1 promoter ZBTB46-binding element reporter constructs
SNAI1/ZBTB46 RE F / TCAGAAGCGCTCAGACCAC
SNAI1/ZBTB46 RE R / CCAATCGGAGGCTCGTCTC
SNAI1/ZBTB46 REM F / AGGCCTCGCTTCGCTCGAATTCCCGCCCCGGA
SNAI1/ZBTB46 REM R / CGAGCGAAGCGAGGCCTCTGCGAGGTGG

Supplementary Table S2. Primer sequences for the RT-qPCR

Gene / 5'-3'
ZBTB46 F / TCCCTGCTGTTCGAGTACCT
ZBTB46 R / CATGTGTCGCTTGAGGATG
SNAI1 F / TCTCTAGGCCCTGGCTGCTA
SNAI1 R / TGTGGAGCAGGGACATTCGG
SNAI2 F / TGGTTGCTTCAAGGACACAT
SNAI2 R / GCAGATGAGCCCTCAGATTT
TWIST1 F / CGGACAAGCTGAGCAAGAT
TWIST1 R / CTGGAGGACCTGGTAGAGGA
VIM F / AGGTGGACCAGCTAACCAAC
VIM R / TCTCCTCCTGCAATTTCTCC
CDH1 F / TTCTGCTGCTCTTGCTGTTT
CDH1 R / TGGCTCAAGTCAAAGTCCTG
GAPDH F / CCAGTAGAGGCAGGGATGAT
GAPDH R / CTTTCATTGTCTTTTCCGCC

Supplementary Table S3. Antibody information for Western blotting

Primary antibody / Clonality / Source / Dilution / Secondary antibody / Source / Dilution
ZBTB46 / Rabbit
polyclonal / GeneTex (GTX121617) / 1/1000 / anti-rabbit IgG / Jackson Labs / 1/5000
AR / Rabbit
monoclonal / Abcam
(ab108341) / 1/1000 / anti-rabbit IgG / Jackson Labs / 1/5000
SNAI1 / Rabbit
monoclonal / Cell Signaling (#3879) / 1/1000 / anti-rabbit IgG / Jackson Labs / 1/5000
β-actin / Mouse
Polyclonal / GeneTex (GTX109639) / 1/1000 / anti-mouse IgG / Jackson Labs / 1/20000

Supplementary Table S4. Antibody information and primer sequences for the ChIP assay

ChIP antibodies
Primary antibody / Species / Clonality / Source / Concentration
ZBTB46 / Mouse / Monoclonal / Santa Cruz (sc-390260) / 5 µg
GAPDH / Mouse / Monoclonal / Novus (NB300-221) / 5 µg
Immunoglobulin G / Mouse / Santa Cruz (sc-2343) / 5 µg
ChIP primers
Site / 5'-3'
SNAI1/46RE F / TCAGAAGCGCTCAGACCAC
SNAI1/46RE R / CCAATCGGAGGCTCGTCTC
Non-SNAI1/46RE F / AGCTCACTGTGGCTTGAATT
Non-SNAI1/46RE R / CCCAGACCTTTCCCACCTT

References

1Doane AS, Danso M, Lal P, Donaton M, Zhang L, Hudis C et al. An estrogen receptor-negative breast cancer subset characterized by a hormonally regulated transcriptional program and response to androgen. Oncogene 2006; 25: 3994-4008.

2Taylor BS, Schultz N, Hieronymus H, Gopalan A, Xiao Y, Carver BS et al. Integrative genomic profiling of human prostate cancer. Cancer Cell 2010; 18: 11-22.

3Yin J, Pollock C, Tracy K, Chock M, Martin P, Oberst M et al. Activation of the RalGEF/Ral pathway promotes prostate cancer metastasis to bone. Molecular and cellular biology 2007; 27: 7538-7550.

4Yin J, Liu YN, Tillman H, Barrett B, Hewitt S, Ylaya K et al. AR-regulated TWEAK-FN14 pathway promotes prostate cancer bone metastasis. Cancer research 2014; 74: 4306-4317.

5Siu MK, Abou-Kheir W, Yin JJ, Chang YS, Barrett B, Suau F et al. Loss of EGFR signaling regulated miR-203 promotes prostate cancer bone metastasis and tyrosine kinase inhibitors resistance. Oncotarget 2014; 5: 3770-3784.

6Liu YN, Yin J, Barrett B, Sheppard-Tillman H, Li D, Casey OM et al. Loss of Androgen-Regulated MicroRNA 1 Activates SRC and Promotes Prostate Cancer Bone Metastasis. Molecular and cellular biology 2015; 35: 1940-1951.

1