Electronic Supplementary Materials to the paper of Makitrynskyy R. et al. Genetic factors that influence moenomycin production in streptomycetes

Table 1S. Oligonucleotides used in this study

Name / Sequence (5’ - 3’) / Notes
38start_KD4 / CGTGCGCAGCGCGGTCTTCGGCTTCGACGGGGTACGGATGAATATCCTCCTTAGTTC / to delete moeB5moeA5 in moeno38-1 (λ-RED system)
moeA5_P3 / AGACGCGCCGGGCGGCCCCCAGTTCGGACCAGATGCCGTAGGCTGGAGCTGCTTCG
P2_KD4 / CATATGAATATCCTCCTTAGTTC / Primer homologous to P2 site of pKD4
alsrev1 / AAATCTAGATCAAGAGCGGCCGGGGTC / to probe moeA5B5 deletion
moeO5up
moeO5rev / AAAAAGCTTCGGGGCGTGCCTTCT
AAATCTAGACCGCCCGCTCCCCGG / To amplify moeO5 (confirmation of cosmid presence in the expression hosts)
O5PFHindIII
O5PRXbaI / ATAAGCTTgtccggcaggaatgcataac
ATTCTAGagttccgtgtggtggtccag / To amplify moeO5p for promoter probe and titration experiments
RtE5F
RtE5R2 / CACACGGAACGGACTTAGC
TGCACACAGGCCTCCATCA / RT-PCR analysis of moeE5 expression
RtO5F
RtO5R2 / CTGTCGAGGTACTCGGTGA
GGAAGAGCTTCCTCGAGAC / RT-PCR analysis of moeO5 expression
rrnAF
rrnAR / CACATGGAAGTCGAACGATG
GCTGCTGGCACGTAGTTAG / RT-PCR analysis of rrnA expression (control)

Table 2S. Homologues of Streptomyces coelicolor pleiotropic antibiotic regulatory genes present in genomes of S. ghanaensis and S. albus

Pleiotropic regulator / Function/protein, length in aa / Effect on actinorhodin production / Reference / Homologues in:
S. ghanaensis / S. albus
abaA (SCO0701) / Unknown function; 147 aa / Positive / Scheu et al. 1997 / 78% (147 aa) / Not detected
abaB (SCO3919) / LysR-type regulator; 301 aa / Negative / Fernandez et al. 1992 / 87% (301 aa) / 72% (311 aa)
absA (SCO3226) / Two-component system (response regulator); 222 aa / Negative / Bibb 2005 / 62% (221 aa) / 45% (223 aa)
absB (SCO5572) / RNase III;272 aa / Positive / Bibb 2005 / 92% (286 aa) / 85% (260 aa)
afsQ1 (SCO4907) / Response regulator; 225 aa / Positive / Ishizuka et al. 1992 / 98% (225 aa) / 95% (228 aa)
afsR (SCO4426) / Antibiotic regulatory protein;993 aa / Positive / Floriano et al. 1996 / 81% (985 aa) / 70% (990 aa)
afsS (SCO4425) / Unknown function;63 aa / Positive / Floriano et al. 1996 / 67% (63 aa) / + (51 aa)**
cprA (SCO6312) / γ-butyrolactone receptor; 215 aa / Positive / Onaka et al. 1998 / 70% (215 aa) / Not detected
dasR (SCO5231) / GntR-family regulator; 254 aa / Negative / Rigali et al. 2008 / 96% (254 aa) / 88% (274 aa)
kbpA (SCO4422) / AfsK kinase inhibitor; 252 aa / Negative / Bibb 2005 / 72% (227 aa) / Not detected
SCO0823 / GntR-type regulator; 146 aa / Positive / Ostash B., unpublished / 64% (150 aa) / 63% (129 aa)
nsdA (SCO5582) / TPR-containing protein; 500 aa / Negative / Li et al. 2006 / 88% (498 aa) / 72% (494 aa)
nsdB (SCO7252) / TPR-containing protein; 502 aa / Negative / Zhang et al. 2007 / 91% (497 aa) / 43% (494 aa)
ppk (SCO4145) / Polyphosphate kinase; 774 aa / Negative / Chouayekh et al. 2002 / 89% (789 aa) / 82% (770 aa)
rapA1(SCO5403) / Two-component system (response regulator); 222 aa / Positive / Lu et al. 2007 / 94% (221 aa) / 87% (221 aa)
relA (SCO1513) / GTP pyrophosphokinase; 847 aa / Positive* / Chakraburty et al. 1997 / 95% (842 aa) / 94% (>772 aa)
relC (SCO4648) / Ribosomal protein; 144 aa / Positive / Ochi 1990 / 98% (144 aa) / 95% (144 aa)
scbA (SCO6266) / γ -butyrolactone synthase; 314 aa / Negative / Takano et al. 2001 / 39% (295 aa) / Not detected
scbR (SCO6265) / γ -butyrolactone receptor; 215 aa / Negative / Takano et al. 2005 / 49% (226 aa) / Not detected
wblA (SCO3579) / Transcriptional factor; 129 aa / Negative / Kang et al. 2007 / 96% (128 aa) / 85% (141 aa)

* - but see Gomez-Escribano et al. 2008.

** - similarity of this hit is largely undetectable due to poor sequence quality, however, the start of afsS ORF is clearly present (Fig. 2S) and surrounding sequences show high-level synteny to SCO4423-SCO4428 segment of S. coelicolor genome.

Fig. 1S. Orientation of afsS and afsR in S. coelicolor chromosome and orthologous pairs in genomes of S. ghanaensis and S. albus. Locations are shown in base pairs.

Supplementary references

Bibb M (2005) Regulation of secondary metabolism in streptomycetes. Curr Opin Microbiol8: 208-215.

Chakraburty R & Bibb MJ (1997) The ppGpp synthetase gene (relA) of S. coelicolor A3(2) plays a conditional role in antibiotic production and morphological differentiation. J Bacteriol179: 5854-5861.

Champness W, Riggle P, Adamidis T & Vandervere P (1992) Identification of Streptomyces coelicolor genes involved in regulation of antibiotic synthesis. Gene115: 55-60.

Chouayekh H & Virolle MJ (2002) The polyphosphate kinase plays a negative role in the control of antibiotic production in Streptomyces lividans. Mol Microbiol43: 919-930.

Kang SH, Huang J, Lee HN, Hur YA, Cohen SN. & KimES (2007) Interspecies DNA microarray analysis identifies WblA as a pleiotropic down-regulator of antibiotic biosynthesis in Streptomyces. J Bacteriol189: 4315-4319.

Fernandez-Moreno MA, Martin-Triana AJ, Martinez E, Niemi J, Kieser HM, Hopwood DA & Malpartida F (1992) abaA, a new pleiotropic regulatory locus for antibiotic production in Streptomyces coelicolor. J Bacteriol174: 2958-2967.

Floriano B & Bibb MJ (1996) afsR is a pleiotropic but conditionally required regulatory gene for antibiotic production in Streptomyces coelicolor A3(2). Mol Microbiol21: 385-396.

Gomez-Escribano JP, Martin J, Hesketh A, Bibb MJ & Liras P (2008) Streptomyces clavuligerus relA-null mutants overproduce clavulanic acid and cephamycin C: negative regulation of secondary metabolism by (p)ppGpp. Microbiology154: 744-755.

Ishizuka H, Horinouchi S, Kieser H, Hopwood DA & Beppu T (1992) A putative two-component regulatory system involved in secondary metabolism in Streptomyces spp. J Bacteriol174: 7585-7594.

Li W, Ying X, Guo Y, Yu Z, Zhou X, Deng Z, Kieser H, Chater KF & Tao M (2006) Identification of a gene negatively affecting antibiotic production and morphological differentiation in Streptomyces coelicolor A3(2). J Bacteriol188: 8368-8375.

Lu Y, Wang W, Shu D, Zhang W, Chen L, Qin Z, Yang S & Jiang W (2007) Characterization of a novel two-component regulatory system involved in the regulation of both actinorhodin and type I polyketide in S. coelicolor. Appl Microbiol Biotechnol77: 625-635.

Ochi K (1990) A relaxed (rel) mutant of S. coelicolor with a missing ribosomal protein lacks the ability to accumulate ppGpp, A-factor and prodigiosin. J Gen Microbiol136: 2405-2412.

Rigali S, Titgemeyer F, Barends S, Mulder S, Thomae AW, Hopwood DA van Wezel GP (2008) Feast or famine: the global regulator DasR links nutrient stress toantibiotic production by Streptomyces. EMBO Rep9:670-675.

Scheu AK, Martinez E, Soliveri J Malpartida F (1997)abaB, a putative regulator for secondary metabolism in Streptomyces. FEMS Microbiol Lett147: 29-36.

Takano E, Chakraburty R, Nihira T, Yamada Y & Bibb MJ (2001) A complex role for the γ-butyrolactone SCB1 in regulating antibiotic production in Streptomyces coelicolor A3(2). Mol Microbiol41: 1015-1028.

Takano E, Kinoshita H, Mersinias V, Bucca G, Hotchkiss G, Nihira T, Smith CP, Bibb M, Wohlleben W & Chater K (2005) A bacterial hormone (the SCB1) directly controls the expression of pathway-specific regulatory gene in the cryptic type I polyketide biosynthetic gene cluster of Streptomyces coelicolor. Mol Microbiol56: 465-479.

Zhang L, Li WC, Zhao CH, Chater KF & Tao MF (2007) NsdB, a TPR-like-domain-containing protein negatively affecting production of antibiotics in Streptomyces coelicolor A3(2). Wei Sheng Wu Xue Bao47:849-854.

1