Construction of recombinant plasmids:

FLAG-tagged KLF2 open reading frame (ORF) was inserted into the pCMV-Tag2B vector (Stratagene, Santa Clara, CA, USA), which was a gift from Dr. Taniguchi.

A pcDNA3.1-SP1 expression vector was purchased from Invitrogen (Shanghai,China).

The full length of TINCR cDNA was synthesized by Invitrogen(Shanghai, China) and subcloned into the Hind III and Sal I sites of pcDNA3.1 vector(Invitrogen,Shanghai, China), named pcDNA3.1-TINCR.

The cDNA encoding STAU1 was PCR-amplified and subcloned into the HindIII and EcoRI sites of the pcDNA3.1-FLAG vector(Invitrogen,Shanghai, China), named pcDNA3.1-FLAG-STAU1. The CDS sequence of STAU1was amplified by PCR using a cDNA library from SGC7901 cells as a template and the following primers pair: cttggtaccgagctcggatccctgtgcATGAAACTTGGAAAAAAACCAATGTATAAG (sense) andaacgggccctctagaTCATTTATCGTCGTCATCTTTGTAGTCGCACCTCCCACACACAG(antisense).

To construct Rluc-KLF2 3’UTR, and Rluc-ARF1 SBS, pLucluciferase vector(Ambion Inc.) carrying the Renilla luciferase (Rluc)reporter gene was digested with an endonucleaseand ligated to the corresponding fragment that encodes human KLF2 3’UTRand ARF1 SBS mRNA.

The KLF2 3’UTR andARF1 SBS mRNAfragments were amplified by PCR using a cDNA library from SGC7901 cells as a template and theprimers listed below:

For KLF2 3’UTR: 5’-cacaactcgagCCGGGACGCCCCCGCCCACCTG-3’ (sense)and5’-aaggatccCAACCCAGCAAAATCTTATAAAAA-3’ (antisense), where the red underlined nucleotides specify the XhoI site, and the blue underlined nucleotides specify the BamHI site.

For ARF1 SBS mRNA: 5’-cacaagtcgacGTGAACGCGACCCCCCTCCCTCTCACTC-3’ (sense) and5’-aaggatccCCAGGTGCCCATGGGCCTACATCCCC-3’(antisense),where the red underlined nucleotides specify the SalI site, and the blue underlined nucleotides specify the BamHI site.

Luciferase reporter assay:

Cells were first transfected with appropriate plasmids in 24-well plates. Next, the cells were collected and lysed for luciferase assay 48h after transfection. The relative luciferase activity was normalized with Renilla luciferase activity. The promoter region of TINCR was PCR-amplified by TaKaRa LA Taq (Takara) and subcloned into the pGL3 basic firefly luciferase reporter. The amplified PCR fragments were then used as a template for generating promoter constructs carrying deletions using specific primers. All PCR products were verified by DNA sequencing.

To construct the luciferase reporter vector, the core promoter of the TINCR gene (-201 to +163, relative to the transcription start site of the TINCR gene) was subcloned into the pGL3 basic firefly luciferase reporter.The primers are listed below:

For full length of TINCR-pGL3-F:ctattctcgagCTGGGATGACCTCGCTGATG (sense) and accaagcttCACGGTCAGCGGTAGCAGCAGC(antisense), where the red underlined nucleotides specify the XhoI site, and the blue underlined nucleotides specify the HindIII site.

For deletion of TINCR-pGL3(TINCR-pGL3-D),we used two primer pairs: ctattctcgagCTGGGATGACCTCGCTGATG (sense) and CCAGAGTGCGCCCGGGGGTCTGGCCACTCAGCACAGAGCC (antisense),and GGCTCTGTGCTGAGTGGCCAGACCCCCGGGCGCACTCTGG (sense)and accaagcttCACGGTCAGCGGTAGCAGCAGC(antisense). The amplified PCR fragments were then used as a template andthe primer for the full length of pGL3-TINCR was used forthe deletion of pGL3-TINCR.

Primers for RT-PCR used in RNA immunoprecipitation (RIP) experiments:

The RT-PCR of MUP mRNAs was performedpreviously reported1, 2. RLuc-KLF2 3’-UTRand RLuc-ARF1 SBS mRNA were amplified using 5’- TGCTGAAGAACGAGCAGTAATTCTA-3’ (sense, which annealed to the pLUC Luciferase vector) and 5’-CTCTGGGTCCAATAAATACCAGTCA-3’ (antisense), 5’-TAAGTACATCAAGAGCTTCGTGGAG-3’ (sense, which annealed to the pLUC Luciferase vector) and 5’- GCCTGGCCGCAGGCTGCGTC-3’(antisense), respectively.

RNA transcriptome sequencing:

Briefly, the mRNA sample was subsequently used in cDNA library construction and Ion Proton sequencing. The cDNA library was prepared using the Ion Total RNA-Seq Kit v2 (Lifetech, Carlsbad, CA, USA, Cat. No. 4479789) following the manufacturer’s instructions. The cDNA libraries were quantitated and qualitatively assessed on the Agilent Bioanalyzer 2200 (Agilent Technologies, Santa Clara, CA, USA). The cDNA libraries were then processed using Proton Sequencing, according to the commercially available protocols. Samples were processed on a OneTouch 2 instrument and enriched on a OneTouch 2 ES station for preparing the template-positive Ion PI™ Ion Sphere™ Particles according to Ion PI™ Template OT2 200 Kit ( Lifetech, Carlsbad, CA, USA,cat. no. 4482286). After enrichment, the mixed template-positive Ion PI™ Ion Sphere™ Particles of two samples were loaded onto 1 P1v2 Proton Chip and sequenced on Proton Sequencers according to the Ion PI Sequencing 200 Kit (Lifetech, Carlsbad, CA, USA,cat. no. 4482283).

Tissue samples and clinical data collection:

In this study,80 patients underwent primary gastric cancer resection at the First Affiliated Hospital of Nanjing Medical University and Subei People’s Hospital of Jiangsu Province. The study was approved by the ethics committee on Human Research of the First Affiliated Hospital of Nanjing Medical University and Subei People’s Hospital of Jiangsu Province. Written informed consent was obtained from all patients.All patients with gastric cancer have been followed up at intervals of 3 months until June 2014, and the median follow-up period was 36 months (range, 20–48 months). Follow-up studies included physical examination, laboratory analysis, and computed tomography if necessary. Disease-free survival (DFS) was defined as the interval between the dates of surgery and recurrence. If recurrence was not diagnosed, patients were censored on the date of death or the last follow-up.

Immunohistochemical (IHC) analysis:

To quantify protein expression, both the intensityand extent of immunoreactivity were evaluated andscored. In the present study, staining intensity wasscored as follows: 0, negative staining; 1, weak staining;2, moderate staining; and 3, strong staining. The scoresof the extent of immunoreactivity ranged from 0 to 3,and were determined according to the percentage ofcells that showed positive staining in each microscopicfield of view (0, <25%; 1, 25%–50%; 2, 50%–75%; 3,75%–100%). A final score ranging from 0 to 9 wasachieved by multiplying the scores for intensity andextent.Using this method, the expression of proteins was scored as 0, 1, 2, 3, 4, 6, or 9. In case of disagreement(score discrepancy1), slides were reexamined and a consensuswas reached by the experts.

RNA interference:

Small interfering RNAs (siRNAs) were chemically synthesized (Invitrogen, Shanghai, China). Transfection of siRNA duplexes into gastric cancer cellswas carried out usingLipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.At 48 h post-transfection, cells were harvested for qPCR or western blot analysis.Synthesized DNA nucleotide fragment encoding short hairpin RNA (shRNA) for knockdown of endogenous TINCR was inserted into pENTRTM/U6 (Invitrogen,Shanghai, China) and pAd/BLOCK-iT™-DEST adenoviral vector (Invitrogen,Shanghai, China), respectively. The same vectors (pENTRTM/U6-shNC and Ad-shNC) with irrelevant nucleotides not targeting any annotated human genes were used as negative controls, named Scrambled RNA.Infection of gastric cancer cells by recombinant adenoviral vector producing shRNA was performed according to the manufacturer's instructions.

Bioinformatic analysis:

StanfordUniversitydeveloped Cluster 3.0 software was used to perform cluster analysis of gene expression, and the results were visualized with TreeView software. GO term enrichment was performed using DAVID with the total set of genes on the appropriate RNA transcriptome sequencing as the background. P-values were calculated using a Bonferroni-corrected modified Fisher’s exact test. The pathway analysis was carried out using the KEGG database3. Two-sided Fisher’s exact test and χ2 test were used to classify the results of the pathway analysis, and the false discovery rate (FDR) was calculated to correct the P-value. AP-value of < 0.05 and an FDR of < 0.05 were used as a threshold to select significant KEGG pathways.

RNA pull-down assay:

Biotin-labeled RNAs were transcribedin vitro with the Biotin RNA Labeling Mix (Roche Diagnostics) and T7 RNA polymerase (Roche Diagnostics), treated with RNase-free DNase I (Roche), and purified with an RNeasy Mini Kit (Qiagen, Valencia, CA). Next, 1 mg whole-cell lysates from SGC7901 cells was incubated with 3μg of purified biotinylated transcripts for 1 h at 25 °C. Complexes were isolated with streptavidin agarose beads (Invitrogen). The beads were washed briefly three times and boiled in sodium dodecyl sulfate (SDS) buffer, and the retrieved protein was detected using the standard western blot technique. The RNA present in the pull-down material was detected using reverse-transcription polymerase chain reaction (RT-PCR) and quantitative real-time PCR (qPCR) analysis.The RT-PCR and qPCR primer pairs were provided in Supplementary TableS1.

Statistical analysis:

All statistical analyses were performed using SPSS 20.0 software (IBM, SPSS, Chicago, IL, USA). The significance of differences between groups was estimated usingthe Student’s t-test, χ2 test, Fisher’s exact test, Mann-Whitney test, Kruskal-wallis test, or Wilcoxon test, as appropriate. A receiver operating characteristic (ROC) curve was established to evaluate the diagnostic value for differentiating between gastric cancer and benign diseases. Disease-free survival (DFS) rates were calculated by the Kaplan–Meier method with the log-rank test applied for comparison. Survival data were evaluated using univariate and multivariate Cox proportional hazards model. Variables with a value of P < 0.05 in the univariate analysis were used in subsequent multivariate analysis on the basis of Cox regression analyses. Pearson correlation analysis was performed to investigate the correlation between TINCR and KLF2 mRNA expression. Two-sided P-values were calculated, and a probability level of 0.05 was chosen for statistical significance.

1Cho H, Kim KM, Han S, Choe J, Park SG, Choi SS et al. Staufen1-Mediated mRNA Decay Functions in Adipogenesis. Molecular Cell 2012; 46: 495-506.

2Kim YK, Furic L, Parisien M, Major F, DesGroseillers L, Maquat LE. Staufen1 regulates diverse classes of mammalian transcripts. Embo Journal 2007; 26: 2670-2681.

3Ogata H, Goto S, Sato K, Fujibuchi W, Bono H, Kanehisa M. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic acids research 1999; 27: 29-34.