Supplemental material
Therapy genetics: the 5HTTLPR a biomarker for response to psychological therapy?
Authors:
Claudi L.H. Bockting1*, Roel J. Mocking2, Anja Lok2, Maarten W.J. Koeter2, Aart H. Schene2
1 Department of Experimental Psychology, University of Groningen, Groningen, The Netherlands
2 Department of Psychiatry, Academic Medical Center, University of Amsterdam, The Netherlands
* Corr. Author:
Material and methods – participants, measures, genotyping procedures and analysis
Results
Acknowledgements
Reference list
Table 1
Table 2
Table 3
Material and Methods
Participants
The current study was part of the DELTA-study, a randomized clinical trial, investigating the effect of CBT on recurrence in 187 euthymic patients1-2. Inclusion criteria of the original trial were: ≥2 previous MDD-episodes in the last 5 years, as defined by the Structured Clinical Interview for DSM-IV disorders (SCID)3; in remission >10 weeks and <2 years ago, as defined as a score <10 on the 17-item Hamilton Depression Rating Scale (HDRS)4; and 18-65 years old. Exclusion criteria were: (a history of) bipolar spectrum disorder or any psychotic disorder, organic brain damage, alcohol and/or drug abuse and/or dependency, or predominant anxiety disorder, all assessed by the SCID. Since neither type of aftercare, nor AD use, was an inclusion or exclusion criterion for the study, with respect to these characteristics, the DELTA sample can be considered naturalistically representative for patients suffering from recurrent MDD. The background, methodology and procedure of the DELTA-study have been described in more detail previously1. Two years after baseline we asked patient to provide DNA for the current study.
All participants provided written informed consent prior to enrolment. The study was approved by the ethics committee of the Academic Medical Center of the University of Amsterdam (MEC 02/048).
Measurements
Primary outcome: relapse/recurrence
Primary outcome relapse/recurrence was assessed using the Structured Clinical Interview for DSM-IV (SCID-I)3. Using this instrument, current and past depressive episodes were assessed at baseline, and at 5 follow-up measurements at 3, 12, 24, 36 and 66 months after baseline. With the follow-up assessments of the SCID, we diagnosed relapses (<6 months after a previous MDE) or recurrences during follow-up, both further addressed as ‘recurrence’ for clarity reasons. The trained SCID evaluators were blind to treatment condition; subjects were instructed not to reveal treatment condition to the interviewers (psychologist/research assistants). All interviews were audio taped. Two independent experienced psychiatrists, blinded to treatment condition, evaluated all occasions of participants meeting the DSM-IV criteria for MDD. In cases of disagreement, the ratings of the psychiatrists were used. Kappa for inter-rater agreement between the interviewers and psychiatrist on categorization of a relapse/recurrence or no relapse/recurrence was .96, indicating high agreement1.
Genotyping procedures and analysis
We collected blood samples at patient’s home. Each subject had 20 ml of blood taken by venepuncture. Genomic deoxyribonucleic acid (DNA) was isolated out of blood using a filter-based method (QIAamp DNA Mini Kit, Qiagen Ltd, United Kingdom). Genotyping was done using a Matrix Assisted Laser Desorption Ionization Time Of Flight (MALDI-TOF) mass spectrometer from Bruker Daltonics. All samples were genotyped in duplicate to increase reliability5. The length of the 5-HTTLPR polymorphism was determined by gel electrophoresis. The region around the polymorphism was amplified by PCR using forward primer tgtaaaacgacggccagtgccagcacctaacccctaat and reverse primer caggaaacagctatgaccaggggagatcctgggaga (M13 primer sequence in italic). The PCR reaction was performed in 10 ml containing 1.5 mM MgCl2, 0.2 mM forward and reverse primer, 0.1 mM dNTP’s, 0.5 Units Hotfire Polymerase (Solis Biodyne, Estonia), Buffer B (Solis Biodyne, Estonia) and 20 ng genomic DNA. The lengths of the four different alleles were: short = 250 bp, long = 298 bp, long + = 320, long ++ = 380 bp. Genotyping of the rs25531 SNP was done by sequencing (Sanger) using Big Dye Terminators (Applied Biosystems). The M13 forward primer tgtaaaacgacggccagt was used for sequencing. 10 ml reactions were performed containing 5 ng of a forward primer, 5 ml PCR product, BDT mix (Applied Biosystems) and 2.5x BDT buffer (Applied Biosystems). The length of the 5-HTTLPR polymorphism was confirmed by looking at the length of the sequenced PCR product.
Statistical analysis
5HTTLPR genotype as predictor for treatment response
Half the study sample was randomly allocated to preventive CT therapy (8 sessions during the first three months after inclusion in the DELTA study). Preventive CT has a protective effect in preventing recurrence that increases with the number of previous depressive episodes1-2. To test whether this intervention modified the relation between 5HTTLPR genotype and recurrence we assessed the significance of the 3-way interaction of treatment condition by 5HTTLPR -genotype by number of previous episodes interaction (intention to treat). To examine potential confounding, we also present the results adjusted for age, gender and antidepressant use by incorporating these variables as covariates in the Cox regression model.
We used PASW statistics 18.0 (IBM SPSS, Inc., 2010, Chicago, IL). We considered p<.05 statistically significant.
Results
Sample characteristics
The genotyping success rate was 99.3% (136/137). In order to perform intention to treat analyses, we imputed missing data (26.7%) using multiple imputations. We focused on 180 Caucasians (non-Caucasians N=7). Genotype distribution for the Caucasian subset (and for the whole sample) was as follows; LL: 29.1% (28.3%); LS: 52.8% (53.5%); SS: 17.9% (17.7%) conformed to the Hardy-Weinberg Equilibrium (for Caucasian sample: F(df1=2.00, df2=38.86)=0.04, p = .96, for the whole sample: F(df1=2.00, df2=26.96)=0.10, p = .91).
Demographic, genetic and psychopathological characteristics of the patients are given in table 1, and show that both groups were comparable on the variables tested (all P’s > .10). Patients in the CBT group were slightly older (mean of 46.3 years in the CBT group versus a mean of 43.6 year in the TAU group).
Over 5.5 years follow-up 76.7% (138/180) experienced a recurrence (75.2% in the SS, 77.3% in the SL/LL). In the whole sample, recurrence rates were 76.1% in the SS and 77.6% in the SL/LL.
Table 1 about here
Unfortunately, the numbers of subjects from other ethnic sub-groups were too small for a separate analysis (N=7).
Effect CBT
As reported before1-2 and shown in table 2, Cox regression intention-to-treat analyses revealed that CBT had a preventive effect on time to recurrence, that increased with increasing number of previous episodes (interaction between previous episodes and treatment condition for Caucasian sample: Wald statistic (1, N = 180) = 7.855, p .05, hazard ratio = .567, 95% confidence interval CI = .381 to .843. For the total sample: Wald statistic (1, N = 187) = 9.150, p < .05, hazard ratioadj = .547, 95% CI = .370 to .809).
Table 2 about here
5HTTLPR as predictor of CBT response
As shown in Figure 1 and table 3, the 5HTTLPR was not significantly associated with treatment response (no significant treatment condition by 5HTTLPR by number of previous episodes interaction effect on time to recurrence; interaction term for the Caucasian sample: Wald statistic (1, N = 180) = .717, p = .418, hazard ratio = .271, 95% CI = .009 to .860). For the total sample, we found comparable results (Wald statistic (1, N = 187) = .552, p = .477, hazard ratio = .324, 95%, CI = .010 to 10.049).
Figure 1 about here
We found comparable results controlling for age and gender (Wald statistic (1, N = 180) = .666, p = .429, hazard ratioadj = .327, 95%, CI = .017 to 6.256). There was no confounding by antidepressant use (Wald statistic (1, N =180) = .724, p = .416, hazard ratioadj = .264, 95%, (CI) = .008 to 8.938).
Table 3 about here
Financial disclosure
The authors report no financial or other relationship relevant to the subject of this article.
Funding/Support
This study was granted by the Health Research Development Council (ZonMw), Department Prevention Program and National Foundation for Mental Health (Fonds Psychische Gezondheid).
Acknowledgement
We are most grateful to the participants of our study. In addition, we express our appreciation to the participating psychiatric sites for their recruitment efforts. We also thank our interviewers and independent raters and specifically Irene Visch for assistance with data management and support. The following colleagues contributed to the DELTA (Depression Evaluation Longitudinal Therapy Assessment) Study: Johanna Assies, Claudi Bockting, Mascha ten Doesschate, Jochanan Huyser, Anja Lok, Maarten Koeter, Guido Nabarro, Aart Schene, Philip Spinhoven, Ieke Visser, Ellie Wekking en Luuk Wouters.
References
1Bockting CLH, Schene AH, Spinhoven Ph, Koeter MWJ Wouters LF, Huyser J, Kamphuis JH. Journal of Consulting and Clinical Psychology 2005; 73: 647-657.
2Bockting CLH, Spinhoven Ph, Wouters LK, Koeter MWJ, Schene AH. Journal of Clinical Psychiatry 2009; 70: 1621-1628.
3First MB, Gibbon M, Spitzer RL, Williams JB. User Guide for the Structured Clinical Interview for DSM-IV Axis 1 Disorders. Washington, DC, American Psychiatric Association. 1996.
4Hamilton M. Journal of Neurology, Neurosurgery and Psychiatry 1960; 23: 6-62.
5Pusch W, Wurmbach JH, Thiele H, Kostrzewa M. Pharmacogenomics 2002; 3: 537-548.
Table 1. Characteristics patients per treatment condition, CBT versus TAU
(N=97) / P
Demographic
Female (%) / 74.4 / 74.2 / .97
Age (Mean, SE) / 43.6±1.0 / 46.3±.90 / .05
Marital status (%) / Single / 28.4 / 19.0
Married / 55.8 / 57.1
Divorced / 13.6 / 20.0
Widowed / 2.0 / 3.9 / .40
Caucasian (%) / 96.0 / 96.1 / .89
Genetic
5HTTLPR (%) / LL / 27.3 / 29.7
LS / 51.6 / 55.5
SS / 21.1 / 14.9 / .97
Illness related
Age of onset (mean, SE) / 27.9±1.3 / 29.0±1.2 / .53
Number of previous episodes
(mean, SE)a / 1.1±.10 / 1.3±.09 / .19
Median number (IQR) / 3±3.8 / 4±3.8
Residual depressive symptoms (mean, SE) / 3.7±.31 / 3.8±.29 / .76
Treatment last MDE (%) / None / 13.3 / 10.3
Psychological intervention / 7.7 / 14.4
Antidepressants / 22.2 / 12.4
Both / 56.7 / 62.9 / .16
Length last MDE (%) / <2 months / 23.3 / 25.6
2-8 months / 46.7 / 39.2
>8 months / 24.4 / 29.9 / .52
Severity last MDE (%) / Mild / 6.2 / 9.3
Moderate / 33.8 / 32.2
Severe / 61.6 / 58.6 / .77
Antidepressant medication (%) / 52.2 / 51.6 / .93
Table 2. Effect CBT on prevention of relapse in recurrently depressed patients, n=180 Caucasians1
Interaction treatment condition by previous episodes2 / 7.855
(9.150) / -.568
(-.603) / .567
(.547) / .005
(.003) / .381 - .843
(.370 - .809)
Treatment condition / .9284
(1.031) / .293
(.316) / 1.340
(1.371) / .336
(.311) / .738 - 2.433
(.743 – 2.532)
Previous episodes2 / 14.334
(18.387) / .535
(.576) / 1.708
(1.779) / .000
(.000) / 1.294 - 2.253
(1.367 – 2.315)
1 Between brakes values for the total sample, N=187,
2 Log transformed
.
Table 3. 5HTTLPR as predictor of CBT response, n=180 Caucasiana
predictor of treatment response / Wald / b / Exp(b) / p / CI
Interaction 5HTTLPR1 by treatment condition by previous episodes2 / .717 (.552) / -1.304
(-1.126) / .271
(.324) / .418
(.477) / .009 - .860
(.010 - 10.049)
5HTTLPR by treatment condition / .498 (.319) / 1.206
(.942) / 3.339
(2.565) / .496
(.585) / .076 - 146.785
(.062 - 106.760)
5HTTLPR by previous episodes
Treatment condition by previous episodes
5HTTLPR
Treatment condition
Previous episodes / .278
(.367)
6.380
(7.976)
.411
(.446)
.952
(.446)
11.009
(14.527) / -.163
(-.182)
-.580
(-.626)
.315
(.332)
.342
.383
.587
(.634) / .850
(.834)
.560
(.535)
1.370
(1.394)
1.408
(1.466)
1.799
(1.885) / .598
(.545)
.012
(.005)
.520
.505
.331
(.273)
.001
(.000) / .463 - 1.559
(.463 - 1.503)
.356 - .879
(.346 - .826)
.520 - 3.613
.521 - 3.729
.705 - 2.814
.521 - 3.729
1.270 - 2.549
1.360 - 2.612
a between brakes values for the total sample, N=187,
1 bi-allelic, SS versus SL-LL as the reference category,
2 log transformed
8