IRS-1 GeneticPolymorphism (r.2963G>A )in Type 2 Diabetes Mellitus Patients associated with Insulin Resistance.
.
Background: Insulin receptor substrate (IRS) molecules are key mediators in insulin signaling. Several polymorphisms in the IRS genes have been identified, but only the Gly to Arg 972substitution of IRS-1, seems to have a pathogenic role in the development of type 2 diabetes. Many polymorphisms described inIRS1gene, especially Gly972Arg substitution are shown to be associated with insulin resistance in type 2 diabetes.
Subjects and methods :This prospective case control study was done during the period from November 2014 to may 2015, all patients were collected from Diabetes and Endocrinology diseases Department and were screened for eligibility in this study. Subjects were divided in two groups: first group consists of 50 diabetic patients , second group consists of 60 non diabetic control group. First group was further subdivided to 33 insulin resistant subgroup and 17 insulin sensitive subgroup (HOMA homeostatic model assessment was done). RFLEPperformed using specific primers for scanning SNPs GLY 972 Arg .
Results: shows significant variation in genetic polymorphism (GG 78%,GA 22 %, AA 2%) vs (GG 100%) and BMI between both groups and highly significant variation in family history, bl sugar, fasting insulin, weight, HbA1C and lipid profile between both groups. It also shows no significant variation in age, sex, family history, bl sugar, height,BMI, HbAIC and lipid profile between insulin resistant and insulin sensitive groups, but there is highly significant variation in insulin level and HOMA between both groups. This study shows no significant relation between genetic polymorphism and (age, sex, family history, insulin sensitivity, insulin level, Wt, height, BMI, HbA1C, lipid profile) but shows significant relation between polymorphism and bl sugar and HOMA IR. Conclusions: IRS1 genetic factor may be a significant genetic determinant for insulin resistance in T2DM patients during severe/acute phase hyperglycemia
Key words : T2DM, Insulin receptor substrate, RFLEP
Introduction 1-
Sort two diabetes mellitus comprises of a variety of dysfunctions portrayed by hyperglycemia and coming about because of the mix of imperviousness to insulin activity, insufficient insulin emission, and inordinate or unseemly glucagon discharge (1).
Insulin resistance (IR) is a condition in which the body's cells get to be impervious to the effects of insulin and therefore, larger amounts of insulin are required to have its appropriate impacts. Along these lines, the pancreas repays by attempting to deliver more insulin. This resistance happens against body's own particular insulin (endogenous) or against the infused insulin (exogenous). The pancreas creates more insulin until it no more can deliver adequate insulin for the body's requests, then glucose rises. Insulin resistance is a dangerous element for improvement of diabetes and coronary illness (2). A great many people with insulin resistance don't know they have it for a long time—until they create type2 diabetes, a genuine, deep-rooted ailment. On the off chance that individuals learn they have insulin resistance right off the bat, they can frequently avoid or postpone diabetes by rolling out improvements to their way of life (3).
Insulin receptor substrate (IRS) atoms are key middle people on insulin flagging and assume a focal part in keeping up essential cell capacities, for example, development, survival, and digestion system. A few polymorphisms in the IRS qualities have been distinguished. However, just the Gly to Arg 972 substitution of IRS-1, acting with natural elements, appears to have a pathogenic part in the advancement of type two diabetes (4). Many polymorphisms described inIRS1gene, located in 2q36-37, especially Gly972Arg substitution are shown to be associated with insulin resistance in type two diabetes (5).
IRS encodes a protein, which is phosphorylated by the insulin receptor tyrosine kinase. Mutations in this gene are associated with type two diabetes and susceptibility to insulin resistance (6).
Previous studies of patients with type two diabetes complicated with acute hyperglycaemic attack discovered the possibility of genetic polymorphism that influences insulin resistance. While the IRS is an important intermediate in insulin signaling & play a key role in maintaining the basic function of the cell so any polymorphism in IRS genesact as a competitive inhibitor of the insulin receptor. Identification of genetic predictors for increase insulin resistance can help in the treatment of T2DM during the acute phase of hyperglycemia. The quantification of genomic DNA samples can be done using PCR-RFLP technique (7).
Therefore, the genetic polymorphisms that may contribute to the worsening of insulin resistance in type two diabetes mellitus (T2DM) with severe hyperglycemia should be identified to optimize management and treatment.
2-Subjects and methods:
2.1. Subjects
This case-control study was conducted during the period from November 2014 to May 2015 in the Clinical Pathology Department, Benha University and all patients were collected from Diabetes and Endocrinology diseases Department at Benha University Hospital and were screened for eligibility in this study. This study was approved by an Ethical Committee according to World Medical Association Declaration of Helsinki .All participants gave their informed written consents. Subjects were divided into two groups: the first group consists of 50 diabetic patients, the second group consists of 60 nondiabetic control group. The first group was further subdivided to 33 insulin resistant subgroup and 17 insulin sensitive subgroup according to HOMA test.
INCLUSION CRITERIA: Blood glucose level greater than 250 mg/dl(severe hyperglycemia), all subjects are over 30 years old, Patients only used insulin during hospitalization.
EXCLUSION CRITERIA: Patients less than 30 years old, Patients used oral hypoglycemic agents during hospitalization, pregnant Patients, Patients with critically illness or exhibited medical conditions andpatients required extensive medical treatment
2.2.methods:
Sampling:
Eight milliliters of venous blood were withdrawn under aseptic precautions after fasting for 10 hours and distributed as follows:
a- 2 milliliters whole blood was put in EDETA vacutainer (violet cap) and mixed up & down gently which was used to measure CBC & to identify Single Nucleotide Polymorphism (SNP) by Polymerase Chain Reaction- restriction fragment polymorphism (PCR/RFLP) method.
b- 2 ml on Na Fluoride serum test tubes, centrifuged at (1500 rpm for 10 minutes). The separated serum is used for the assay of fasting blood sugar.
c- 1.5 plain test tubes without anticoagulant. The plain test tubes were left till coagulation. After coagulation, samples were centrifuged (1500 rpm for 15 minutes). The separated serum was used for the assay of the lipid profile.
d-The rest of blood volume was put in plain tube (red cap) and left to clot then centrifuged (at 2000 rpm for 10 mins for assay of insulin.
A-Fasting blood sugar applying glucose enzymatic colorimetric method
B-Lipid Profile: (Total Cholesterol, High-denisty Lipoprotein Cholesterol, and Triglycerides) Biosystem A15 auto-analyzer applying colorimetric method. Low-denisty Lipoprotein Cholesterol was calculated according to "Friedwald's equation":
LDL-C = Total cholesterol-(HDL-C+TG/5)
All biochemical tests were done using Biosystem A15 auto-analyzer
C- Glycated HB:- was done by Stanbio Glycohemoglobin procedure, Cat. No. 0350, Lot. No. 26121 . Principle of this method:-(Quantitative Colorimetric )
D- Fasting insulin level:- using CALBIOTECH –catalog No. IS130D kit, for determination of human Insulin in human serum or plasma using the ELISA technique.
--- Insulin resistance measurement: HOMA homeostatic model assessment was done, HOMA- IR (Homeostasis Model Assessment of Insulin Resistance) it was calculated using the equation HOMA-IR = fasting glucose (mg/dl) x fasting insulin (iu/ml) /405.Cutoff point to define insulin resistance is ≥ 3.8
E- Genetic study: performed using specific primers for scanning SNPs GLY 972 Arg.The forward and reverse primer were 5′AGTCTGGCTACTTGTCTGGC3′ and 5′ATGAGTTGTCCCCGTCAGA3′
DNA extraction method:2.2.1.
The genomic DNA was separated utilizing Thermo scintific Gene-JET entire blood genomic DNA filtration, specimens were processed with proteinase K in lysis arrangement, the lysate was blended with ethanol and stacked into purging section where the DNA ties to the silica film. Contamination is adequately uprooted by washing the section with arranged wash cradle. Genomic DNA was then eluted under a low ionic strenghth condition with the elution under the elution buffer.
2.2.2 DNA quantification:
A total of 10 μL of DNA solution was diluted with 990 μL of high grade water. The absorbance (OD) of the DNA solution was measured at wavelengths of 260 nm and 280 nm using a UV- Spectrophotometer, and the OD260/OD280 ratio was determined. A ratio of 1.8 –2.0 indicates the range of ultraviolet absorbance due to nucleic acids. The amount of DNA (in µg/mL) was determined according to Eq 1. DNA conc = A x 100 x 50 µg/mL/100 …
2.2.3.Restriction Fragment Length Polymorphism (RFLP):
Thermo Scientific Taq green master mix containing Taq DNA polymerase, optimized buffer, MgCl2 and dNTPs supplemented with two tracking dyes that not interfere with PCR performance and compatibility with the downstream application, The dyes have absorption peaks at 424 NM and 615 NM.
First Dream Taq master mix was thawed and vortexed and centrifuged,then thin walled PCR tube was placed on ice. Twenty-fiveUl of master mix,1 uM forward and reverse primers, 1 ug template DNA, then completed to 50 Ul by nuclease free water, then samples were vortexed and spined down and the reaction mixture was covered by 25 Ul mineral oil. PCR thermal cycling conditions: initial denaturation 95 C two min,denaturation 95 C 30 sec, annealing 30 sec, extension 72 C 10 min for 40 cycles then 10 Ul of PCR mixture was loaded on the gel. The resultant restriction fragments were ascertained on a 3% agarose gel. PCR amplification products were digested with BstNI restriction enzyme for the IRS1 gene. a solution of 10 µL containing 7 µL of PCR product, 1 µL of 10x NE-Buffer solution, restriction enzymes (0.2 μL), 0.1 μL 100x BSA, and nuclease-free water, the solution was incubated for 1 h at 60 C . TAE gels containing 2.0 or 2.5 % agarose were electrophoresed at 100 V for 50 min. The DNA bands were observed in a gel.
The studied rs1801278 SNP comprised of G and Aalleles. G and A nucleotide change results in GGG and AGGcodonchanges that results in change in glycine aminoaid into arginine. It is located on long arm of chromosome 2 within IRS1 gene.
DNA ladder:
Thermo scientific Gene ruler 50bp DNA ladder used for sizing and approximate quantification of wide range double strand DNA on an agarose gel, this ladder composed of individual DNA fragments 1000,900,800,700,600,500,400,300,250,200,150,100,50 containing two references bands (500 and 250 bp), it was premixed with 6x DNA loading dye and loading buffer 10 Mm Tris-HCl (PH 7.6),10 Mm EDTA.
3.Data analysis:
The data were tabulated and analyzed using the computer program SPSS version 16 (Spss Inc, Chicago, USA)to obtain: Quantitative data were calculated in the form of Mean and standard deviation, frequency and distribution for quantitative data, the significance of difference was tested using: -Student's t-testand Mann Whitney Test (U test)that was used to compare the mean of two groups of quantitative data. Categorical data: Inter-group comparison was performed by using chi-square test (X2-value) and Fisher exact test (FET). Regression analysis: Logistic regression analysis was use for prediction of risk factors
Results:
In this study, ID of the IRS1 r.2963G>A (p.Gly972Arg) quality polymorphismdepended on the SNP reference number (rs 1801278). The polymorphism happened when nucleotide G at amino corrosive glycine (GGG) at codon 972 was changed to nucleotide An and amino corrosive arginine (AGG). This sample of individuals was selected randomly from population in Qaliobeya Governorate in lower Delta, Egypt. Applying Hardy Weinberg equation, revealed that rs1801278 genotypes in both cases and control subjects were in HW equilibrium.The present study was conducted on 100 T2DM cases, their mean age was 49.3 (SD=6.7) years. They comprised of 23 males (46%) and 27 females (54%). Control group was selected to be matched in age and gender.No significant differences were found in anthropometric measures between studied groups. Cases had significantly higher proportion of family history when compared to control group. TG, TC, HDL, LDL, FBG, FPI, HOMA-IR, HBA1C, IR were significantly higher in T2DM when compared to control groups.(Tab: 1).Taking GG genotype and G allele as a reference, GA, GA+AA genotypes and A allele showed significantly higher frequency in T2DM when compared to control group, with higher risk to develop T2DM within healthy control subjects (Tab: 2).
Fig 1 demonstrates the example of electrophoresis for IRS1 genotype r.2963G>A (p.Gly972Arg), which was broke down utilizing the PCR-RFLP test. BstNI cut the PCRitem at position 5'- CC/WGG-3' to createsections that were 108 bp, 81 bp, 51 bp, and 23 bp in the IRS1-972A allele and 159 bp, 81 bp also, 23 bp in the IRS1-972G allele. The 51 and 23 bp sections were just unmistakably obvious underthe bright light transillumination.
FBG, FPI, HOMA-IR were significantly higher in patients with IR when compared to those sensitive to insulin. Lipid profile and HBA1C did not differ significantly according to IR.(Tab:3). Taking GG as a reference,rs1801278GA+AA genotype and A allele showed significantly higher proportion in IR when compared to IS, with higher risk to develop IR within T2DM cases. (Tab: 4). Logistic regression analysis was conducted for prediction of IR within T2DM cases. using age, gender, BMI, FH, laboratory data and rs1801278 genotypes as covariates. Higher FBG, FPI, HOMA-IR, GA+AA genotypes were associated with higher risk to develop IR in univariable analysis. Taking these covariates with significant association in univariable analysis into multivariable analysis revealed that FPI, HOMA-IR, GA+AA genotypes were considered as independent risk factors to develop IR within T2DM patients. (Tab: 5).
.
5.Discussion:
The results of this study demonstrated that IRS-1 quality G→A (Gly 972 Arg) SNP genotype frequencies of genotype homozygous (GG) and heterozygous (GA) were predominant in sort two DM patients, separately (GG) 72% (GA) 24%, (AA) 2% in insulin resistent subgroup and (GG) 82%, (GA) 17% in insulin sensitive subgroup, homozygous (AA) was truant in this subgroup) and genotype (GG) indicated 100% in control bunch. Arg 972 IRS-1 polymorphism might partake in the improvement of insulin resistance and diabetes by debilitating the capacity of insulin to enact the IRS-1/PI3-kinase/Akt flagging pathway, thus prompting imperfections in glucose transport, glucose transporters translocation and glycogen (8)
Other studies at the molecular level revealed that the r.2963 IRS1 polymorphism G> A (p.Gly972Arg) acted as a competitive inhibitor to the IR and IGF-1R autophosphorylation. The IRS1 gene polymorphism allows the IRS1 gene to act as an inhibitor of IR kinase, causing insulin resistance (9)
IRS1 polymorphism G>A (p.Gly972Arg) contribute to insulin resistance by weakening the ability of insulin to activate the signaling pathway of IRS1/PI3 kinase/Akt/glycogen synthase kinase-3 in insulin-sensitive tissues (2). In a study done found that showed that IRS1 gene polymorphisms increased insulin resistance in T2DM patients with severe hyperglycemia. Only the IRS1 Gly972Arg gene polymorphism affects insulin resistance in T2DM patients. This result is similar to the results of studies conducted by (9) and (10), also found that the r.2963G>A (p.Gly972Arg) IRS1 gene polymorphism occurs in patients with insulin resistance, and these polymorphisms also affect insulin resistance. The rs2943641 inIRS1was found to beassociated with type 2 diabetes, insulin resistance and hyperinsulinemia in 3 European populationscomprised of over 14,000 individuals (11).low relationship in our study is conceivably because of various distinctive qualities and variations thought to be compelling being developed of insulin resistance and sort 2 diabetes. Like the IRS1 polymorphism, no contemplates have researched IRS2 polymorphisms in T2DM patients who endure extreme or intense hyperglycemia.
6-Conclusions:
The IRS1 genetic polymorphism (r.2963G>A) may be a significant genetic determinant for insulin resistance in T2DM patients duringacute hyperglycemia.
Tab (1):Mean Fasting Serum Glucose, Insulin, HOMA, and Lipid Profile Concentration in Type 2 Diabetic Patients and the Control Group.
.Table (1). Comparison of laboratory data between studied groups.
Control
/T2DM
/p
N=60
/ N=50Median / Range / Median / Range
Triglycerides (mg/dl)
/ 111.5 / 100 / 140 / 150.3 / 150 / 152 / <0.001Total cholesterol (mg/dl)
/ 183.5 / 165 / 200 / 201.4 / 201 / 202 / <0.001HDL-C (mg/dl)
/ 51.0 / 40 / 70 / 24.7 / 25 / 25 / <0.001LDL-C (mg/dl)
/ 107.4 / 95 / 127 / 146.5 / 66 / 148 / <0.001Fasting blood glucose (mg/dl)
/ 85.5 / 74 / 103 / 293.5 / 240 / 490 / <0.001Fasting plasma insulin
/ 7.1 / 6.4 / 7.8 / 7.8 / 7.6 / 8.8 / <0.001HOMA-IR
/ 1.3 / 1.4 / 1.7 / 5.7 / 4.5 / 9.8 / <0.001HBA1C (%)
/ 4.9 / 4.1 / 5.6 / 7 / 6.6 / 7.5 / <0.001N / % / N / %
Insulin resistance
/ 0 / 0 / 33 / 66 / <0.001Numerical data are expressed as median, range, compared by Man Whitney test. Categorical data are expressed as number and percentage; compared by Fisher exact test.
SI conversion factors: To convert cholesterol to mmol/L, multiply values by 0.0259
SI conversion factors: To convert triglycerides to mmol/L, multiply values by 0.0113
SI conversion factors: To convert glucose to mmol/L, multiply values by 0.0555.
SI conversion factors: To convert insulin to µIU/m, multiply values by 6.945
HOMA: homeostatic model assessment.
Table (2). Comparison of rs1801278 (alleles and genotypes) in all studied T2DM cases patients and healthy control subjects.
Control
/Cases
/ P / OR / 95% CIN=60
/ N=50N / % / N / %
GG / 54 / 90 / 35 / 70 / - / R / - / -
GA / 6 / 10 / 13 / 26 / .025 / 3.343 / 1.162 / 9.617
AA / 0 / 0 / 2 / 4 / .999 / - / - / -
GA+AA / 6 / 10 / 15 / 30 / .011 / 3.857 / 1.366 / 10.890
G / 114 / 95 / 83 / 83 / .004 / 3.892 / 1.471 / 10.294
A / 6 / 5 / 17 / 17
R, reference; OR, odds ratio; CI, confidence interval. Logistic regression test was used.
Table (3). Comparison of laboratory data according to IR.
Insulin sensitive
/Insulin resistant
/p
N=17
/ N=33Median / Range / Median / Range
Triglycerides (mg/dl)
/ 149.9 / 150 / 151 / 150.4 / 150 / 152 / .448Total cholesterol (mg/dl)
/ 201.3 / 201 / 202 / 201.4 / 201 / 202 / .656HDL-C (mg/dl)
/ 24.7 / 25 / 25 / 24.7 / 25 / 25 / .958LDL-C (mg/dl)
/ 146.5 / 146 / 147 / 146.4 / 66 / 148 / .806Fasting blood glucose (mg/dl)
/ 258 / 240 / 275 / 315 / 268 / 490 / <0.001Fasting plasma insulin
/ 7.7 / 7.6 / 8.4 / 8.1 / 7.6 / 8.8 / .005HOMA-IR
/ 4.9 / 4.5 / 5.1 / 6.3 / 5.2 / 9.8 / <0.001HBA1C (%)
/ 7 / 6.6 / 7.5 / 7 / 6.6 / 7.5 / .742Numerical data are expressed as median, minimum and maximum, compared by Man Whitney test.
Table (4). Comparison of rs1801278 (genotypes and alleles) according to IS all studied T2DM patients.
Insulin sensitive
/Insulin resistant
/ P / OR / 95% CIN=17
/ N=33N / % / N / %
GG / 15 / 88.2 / 20 / 60.6 / R
GA / 2 / 11.8 / 11 / 33.3 / .076 / 2.317 / .917 / 5.851
AA / 0 / 0 / 2 / 6.1 / 1
GA+AA / 2 / 11.8 / 13 / 39.4 / .043 / 2.536 / 1.030 / 6.249
G / 32 / 94.1 / 51 / 77.3 / .034 / 4.706 / 1.009 / 21.955
A / 2 / 5.9 / 15 / 22.7
R, reference; OR, odds ratio; CI, confidence interval. Logistic regression test was used.
Table (5). Regression analysis for prediction of IR within T2DM cases.
Univariable / Mltivariablep / OR / 95% CI / p / OR / 95% CI
Age (years) / .662 / 1.020 / .934 / 1.113
Gender / .624 / 1.345 / .412 / 4.388
BMI (kg/cm2) / .889 / .986 / .811 / 1.199
Family history / .488 / 1.560 / .445 / 5.474
Triglycerides (mg/dl) / .699 / 1.194 / .485 / 2.943
Total cholesterol (mg/dl) / .831 / 1.153 / .311 / 4.269
HDL-C (mg/dl) / .950 / 1.142 / .018 / 7.010
LDL-C (mg/dl) / .828 / .918 / .426 / 1.980
Fasting blood glucose (mg/dl) / .035 / 1.392 / 1.023 / 1.893 / .247 / 1.054 / .964 / 1.153
Fasting plasma insulin / .005 / 2.940 / 1.991 / 9.634 / .018 / 2.241 / 1.269 / 11.633
HOMA-IR / .008 / 1.321 / 1.075 / 1.624 / .023 / 1.288 / 1.001 / 8.179
HBA1C (%) / .710 / 1.456 / .201 / 10.528
rs1801278 (GA+AA) / .043 / 2.536 / 1.030 / 6.249 / .018 / .895 / .429 / 1.867
References:
1-Lončar A, Blaslov K, Bulum T, Duvnjak L. The effect of GLP-1 analogues on lipid profile in type 2 diabetic patients–a retrospective observational study. Diabetologia Croatica. 2015 Jan 1;44(2):59-66.
2-Erica Oberg ND. Type 2 Diabetes Diet Plan: List of Foods to Eat and Avoid (2010).
3-Häring HU, Merker L, Seewaldt-Becker E, Weimer M, Meinicke T, Broedl UC, Woerle HJ, EMPA-REG MET Trial Investigators. Empagliflozin as add-on to metformin in patients with type 2 diabetes: a 24-week, randomized, double-blind, placebo-controlled trial. Diabetes care. 2014 Jun 1;37(6):1650-9.
4-SESTI G, FEDERICI M, HRIBAL ML, LAURO D, SBRACCIA P, LAURO R. Defects of the insulin receptor substrate (IRS) system in human metabolic disorders. The FASEB Journal. 2001 Oct 1;15(12):2099-111.
5-Huri HZ, Makmor-Bakry M, Hashim R, Mustafa N, Ngah WZ. Optimisation of glycaemic control during episodes of severe/acute hyperglycaemia in patients with type 2 diabetes mellitus. International journal of clinical pharmacy. 2012 Dec 1;34(6):863-70.
6- Brown GR, Hem V, Katz KS, Ovetsky M, Wallin C, Ermolaeva O, Tolstoy I, Tatusova T, Pruitt KD, Maglott DR, Murphy TD. Gene: a gene-centered information resource at NCBI. Nucleic acids research. 2014 Oct 29;43(D1):D36-42.
7-. Huri HZ, Min YS, Pendek R. Episodes of hypoglycemia and hyperglycemia during the use of sliding scale insulin in hospitalized diabetes patients (2011).