Amidase Activity Is Essential for Medial Localization of Amic in Caulobacter Crescentus

Supplementary Data

Amidase activity is essential for medial localization of AmiC in Caulobacter crescentus

Amrita Dubey1 and Richa Priyadarshini1*

Department of Life Sciences1, School of Natural Sciences, Shiv Nadar University, NH91, Tehsil Dadri, Gautam Buddha Nagar, Uttar Pradesh, 201314, India.

Running head: Enzymatic activity of AmiC is essential for septal localization

*Address correspondence to Richa Priyadarshini, Department of Life Sciences, School of Natural Sciences, Shiv Nadar University, NH91, Tehsil Dadri, Gautam Buddha Nagar, Uttar Pradesh, India. Email:

Plasmid construction

pNTPS138amiC-mCherry: The C-terminus region of CC1876 was amplified using primers Fw: 5’ cccccaagctttctggccttggcgtctgcgcctgtc 3’ and Rev: 5’ cccccgtcgacgagacttgcgaagacccgaggagaaatag 3’ and the fragments were ligated into pKS-mCherry at SalI and HindIII sites and then the AmiC-mCherry fragment was cut from pKS-mCherry with XbaI and HindIII sites and ligated into pNTPS138 plasmid which was used to transform CB15N.

pAD101: CC1876 was amplified using primersFw:5’ccccccatatgcgtagaggtctcatcaatttcgc 3’and Rev: 5’ CCCCCGGTACCAGACTTGCGAAGACCCGAGG 3’and fragments were inserted into pRW431 plasmid using NdeI and KpnI sites making a pxylAmiC fragment. This fragment was then cut out using EcoRI and KpnI sites and ligated into pJS14 plasmid in opposite orientation of the lacZ promoter such that AmiC is only induced by xylose.

pAD102: 1830 bp of DipM were amplified with primers Fw: 5’ CCCCCCATATGATGAGGCAGTTGTGGACG 3’ and Rev: 5’ CCCCCGGTACCTCAGCGCGGCAGCACCAG 3’. The resulting fragment was ligated into vector pJS14 equally treated with NdeI and KpnI.

pXCFPN-5-fzlC: 1731bp of FzlC were amplified with primers Fw: 5’ CCCCCGGTACCATGGCCGGTAAGCCCCCC 3’ and Rev: 5’ CCCCCGCTAGCCTAGCCCTCGGCCTTGGTCAG 3’. The resulting fragment was cloned into vector pXCFPN-5 equally treated with KpnI and NheI.

pXCHYC-2-amiC: CC1876 was amplified using primers Fw:5’ ccccccatatgcgtagaggtctcatcaatttcgc 3’and Rev: 5’ CCCCCGGTACCAGACTTGCGAAGACCCGAGG 3’ and the fragments were cloned into pXCHYC-2 using NdeI and KpnI sites.

pVCHYC-2-amiC: CC1876 was amplified using primers Fw: 5’ccccccatatgcgtagaggtctcatcaatttcgc 3’and Rev: 5’ CCCCCGGTACCAGACTTGCGAAGACCCGAGG 3’and the fragments were cloned into pVCHYC-2 using NdeI and KpnI sites.

pXCHYC-2-amiC Δ(AA 132-391): CC1876 (AA1-131) was pcr amplified with primers Fw: 5’ CCCCCCATATGATGCGTAGAGGTCTCATC 3’ and Rev:5’ CCCCCGGTACCCGGCGGCAGCAGGAACCTGCG 3’ . The resulting fragment was then ligated with vector pXCHYC-2 also digested with NdeI and KpnI.

pAD103: CC1876 (AA1-131) was pcr amplified with primers Fw: 5’ CCCCCCATATGATGCGTAGAGGTCTCATC 3’ and Rev: 5’ CCCCCGGTACCCTACGGCGGCAGCAGGAACCTGCG 3’ The resulting fragment was ligated into vector pJS14 equally treated with NdeI and KpnI.

pXCHYC-2 -amiCH182A: CC1876 was amplified using primers Fw: 5’ ggtggtcgtgatcgacgccggcgccggcggcaaggactccggcgctg 3’and Rev: 5’ cagcgccggagtccttgccgccggcgccggcgtcgatcacgaccacc3’ and the fragments were cloned into pXCHYC-2 using NdeI and KpnI sites.

pXCHYC-2-amiCE196A: Site-directed mutagenesis was performed by using the QuikChange method (Stratagene).AmiC active site mutant was created by introducing point mutation at position 196 by replacing glutamate at active site with alanine. Primers used for site-directed mutagenesis are FP (5’cgctgtcggcgccaacatctacgCgaaggaggtcacgctcgcggccg3’) and RP (5’cgctgtcggcgccaacatctacgCgaaggaggtcacgctcgcggccg3’).pXCHYC-2 plasmid carrying amiC was used as a template. Finally, Dpn I enzyme was used to digest the parental plasmid whereas the mutant plasmids were transformed into DH5α. Transformants were screened on LB plates with selected antibiotics and mutant clones were confirmed by sequencing.

pXCHYC-2-amiCH250A: Site-directed mutagenesis was performed by using the QuikChange method (Stratagene).AmiC active site mutant was created by introducing point mutation at position 250 by replacing histidine at active site with alanine. Primers used for site-directed mutagenesis are FP (5’cgccgacctgtttatctcgctgGCcgccgactccggtccggacgcga3’) and RP (5’TCGCGTCCGGACCGGAGTCGGCGGCCAGCGAGATAAACAGGTCGGCG3’). pXCHYC-2 plasmid carrying amiC was used as a template. Finally, Dpn I enzyme was used to digest the parental plasmid whereas the mutant plasmids were transformed into DH5α. Transformants were screened on LB plates with selected antibiotics and mutant clones were confirmed by sequencing.

pAD104: Site directed mutagenesis was performed with primers Fw: 5’ ggtggtcgtgatcgacgccggcgccggcggcaaggactccggcgctg 3’and Rev: 5’cagcgccggagtccttgccgccggcgccggcgtcgatcacgaccacc 3’ using pJS14pxylamiC as a template. The resulting product was digested with DpnI enzyme and transformed into DH5alpha.

pXCHYC-2-DipM: 1830 bp of DipM were amplified using primers Fw : 5’ CCCCCCATATGATGAGGCAGTTGTGGACG 3’ and Rev: 5’ CCCCCGGTACCGCGCGGCAGCACCAG 3’ and the fragments were cloned into pXCHYC-1 using NdeI and KpnI sites.

pAD105: 1188 bp of amiC were amplified with primers Fw: 5’ CCCCCGAATTC GAGGAGGAAGTCATCATGCGTAGAGGTCTC 3’ and Rev: 5’ CCCCCGGTACCCTAAGACTTGCGAAGACCC 3’. The resulting fragment was then ligated with vector pBAD18 also digested with EcoRI and KpnI.

pET15bamiC: AmiC gene was amplified with primers Fw: 5’ CCCCCCATATGAAGGGACCCGCCGCGCCCGCC 3’ and Rev: 5’ CCCCCGGATCCCTAATGATGATGATGATGATGAGACTTGCGAAGACC 3’ without its signal sequence. The resulting fragment was then ligated with vector pET15b also digested with NdeI and BamHI .

pET15bamiCH182A: AmiCH182A gene was amplified with primers Fw: 5’ CCCCCCATATGAAGGGACCCGCCGCGCCCGCC 3’ and Rev: 5’ CCCCCGGATCCCTAATGATGATGATGATGATGAGACTTGCGAAGACC 3’ without its signal sequence.pJS14plasmid carrying amiCH182Awas used as a template The resulting fragment was then ligated with vector pET15b also digested with NdeI and BamHI .

Strain construction

RP1:Plasmid pXCHYC2-amiC was integrated into the xylose locus making a full length C-terminus amiC-mCherry under the control of xylose promoter

RP2: Strain carrying CB15N cc2007::pGVan2007 YFP was mated with S17-1 carrying pXCHYC-2amiC

RP3: CJW3231 was transduced with phage lysate from strainYB1585

RP4: Transduce strain CJW2141 with phage lysate from strain RP1.

RP5: Plasmid carrying pNTPS138amiC-mCherry was transformed into CB15N and Ist cross over creates C-terminus amiC-mCherry fusion at the native locus.

RP6: S17-1 carrying pXCHYC-2 amiC Δ (AA 132-391) was mated with CB15N.

RP7: Plasmid pXCHYC-2-amiCH182A was electroporated into CB15N.

RP8: S17-1 carrying pJS14pxylamiC was mated with CB15N.

RP9: CJW1822 was mated with S17-1/pJS14pxylamiC.

RP10: RP1 was mated with S17-1/pJS14pxylamiC.

RP11:S17-1 carrying pXCFPN-5-fzlC was mated with CB15N.

RP12: RP8 was transduced with the phage lysate from RP11.

RP13: S17-1/pJS14pxylamiC was mated with strain 2141

RP14:S17-1 carrying pJS14pxylamiC Δ(AA 132-391) was mated with CB15N.

RP15: S17-1 carrying pJS14pxylamiCH182A was mated with CB15N

RP16: S17-1 carrying pJS14pxyldipM was mated with CB15N

RP17: RP16 was transduced with the phage lysate from RP1.

RP18: RP11was transduced with the phage lysate from strain CJW3231.

RP20: Plasmid pAD105 was transformed into DH5alpha.

RP21: E. coli amidase mutants ΔamiA (JW2428-1) andΔamiC( JW5449-1) was obtained from Keio collection (Baba, et al., 2006). ΔamiA andΔamiC mutation was transferred to MG1655 using P1 phage lysate. To construct ΔamiAC , pCP20 an ampicillin and chloroamphenicol resistance plasmid that shows temperature-sensitive replication and thermal induction of FLP synthesis was used. Firstly, kan resistant mutants (ΔamiA) were transformed with pCP20 by plating the transformation on chloramphenicol. Again, transformants were patched on kan and LB plate and incubated at 42°C (to lose pCP20). Colonies obtained from LB plate were further streaked on LB amp (to confirm loss of pCP20). The resulting strain was transduced with Phage lyaste of ΔamiC respectively to obtained ΔamiAC. Finally, pBAD18plasmid was electroplated into ΔamiAC to generate strain RP21.

RP22: Plasmid pAD105 was electroplated into ΔamiACto generate strain RP22.

RP23: S17 carrying pXCHYC2-DipM was mated with RP8.

RP24: BL21(DE3) was transformed with pET15b carrying amiC

RP26: RP25 was transduced with the phage lysate from RP1.

RP28: RP27 was transduced with the phage lysate from RP1.

RP29: RP27 was transduced with the phage lysate from CJW1822.

RP30: Plasmid pXCHYC-2-amiCE196A was electroporated into CB15N.

RP31: Plasmid pXCHYC-2-amiCH250A was electroporated into CB15N.

RP32: BL21(DE3) was transformed with pET15b carrying amiC H182A.

RP33: Plasmid pJS14 was electroporated into CB15N.

Figure Legends

Fig. S1Medial localization of AmiC. Cells of strain RP5 (CB15N amiC::pNTPS138amiC-mCherry) carrying AmiC-mCherry at the native locus were synchronised and time course microscopy was performed. Fluorescence micrograph representing localization of AmiC-mCherry to the mid cell. (Scale bar: 2 µm)

Fig. S2 Alignment of amidase protein sequence from C.crescentus and E.coli. Represenation of multiple sequence alignment of amidase protein sequence from C.crescentus and E. coli. Conserved residues impotant for catalysis in C.crescentus (AmiC) and E.coli (AmiCEC) are highlighted in green.

Fig. S3 Catalytic amino acid residues are essential for medial localization of AmiC.Strain RP30(CB15N xylX::pXCHYC-2-amiCE196A) carrying AmiCE196A variant (A) and strain RP31(CB15N xylX::pXCHYC-2-amiCH250A) carrying AmiCH250A variant (B) were tagged with mCherry. Expression of AmiC-mCherry variants were observed by the addition of 0.3% xylose and analyzed by DIC and fluorescence microscopy. (Scale bar: 2 µm)

Fig. S4AmiC PG hydrolytic activity is responsible for cell lysis. DIC images of (A) strain RP8 (CB15N/pAD101),(B) strain RP14 (CB15N/pAD103) and (C)strain RP15 (CB15N/pAD104). Cells were grown overnight in PYE medium supplemented with 0.2% glucose. Cells were washed with PYE, diluted 1:100 in fresh PYE medium and induced with 0.3% xylose at an OD600 0.2. Samples were visualized by DIC microscopy.(Scale bar: 2 µm)

Fig. S5Colocalization of AmiC and FzlC. Fluorescence micrographs representing localization of CFP-FzlC and AmiC-mCherry CFP-FzlC in cells of strain RP18 (CB15N xylX::pXCFPN-5-fzlC van::pVCHYC-2amiC).Expression of AmiC-mCherry and CFP-FzlC was induced by the addition of 0.5mM vanillic acid and 0.3% xylose respectively. (Scale bar: 2 µm)

Fig. S6Cell lysis requires PG hydrolytic activity of amidase. Cells of strain RP15 (CB15N/pAD104) (A) and RP14 (CB15N/pAD103) (B) were grown overnight in PYE medium supplemented with 0.2% glucose at 30ºC. Cells were washed with PYE, diluted 1:100 in fresh PYE medium and induced with 0.3% xylose at an OD600 0.1. Cells were treated with cephalexin at an OD600 0.2. Subsequently, time lapse was performed and samples were visualized by DIC microscopy. (Scale bar: 2 µm)

SUPPLEMENTARY MOVIE LEGENDS

Movie S1. Representative time lapse movie of strain RP4 showing cell lysis in absence of PBP3. (Scale bar: 2 µm)

Movie S2. Representative time lapse movie of strain RP1 showing cell lysis when cell division was inhibited by cephalexin. (Scale bar: 2 µm)

Movie S3. Representative time lapse movie of strain RP3 showing cell lysis in FtsZ depleted cells. (Scale bar: 2 µm)

References

Baba T, Ara T, Hasegawa M, Takai Y, Okumura Y, Baba M, Datsenko KA, Tomita M, Wanner BL, Mori H.2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol 2:2006 0008.