Supplementary material (ESI) for Chemical Communications
This journal is © The Royal Society of Chemistry 2004
Electronic Supplementary Information
An Efficient Method to Perform Milliliter-Scale PCR Utilizing Highly Controlled Microwave Thermocycling
Kristina Orrlinga, Peter Nilssona, Mats Gullberg*b, Mats Larhed*a
aOrganic Pharmaceutical Chemistry, Department of Medicinal Chemistry, Uppsala Biomedical Centre, UppsalaUniversity, P. O. Box 574, SE-751 23 Uppsala, Sweden.
b The Beijer Laboratory, Department of Genetics and Pathology, Rudbeck Laboratory, SE-751 85 Uppsala, Sweden.
Microwave-assisted PCR
General: All microwave-heated thermocyclings were performed in an Optimizer EXP provided from Personal Chemistry. Microwave-transparent borosilicate glass vials (EmrysTM process vials) and Teflon-coated magnetic stirring bars were used in all PCR amplifications. The instrument software allowed individual programming of time, temperature, pressure, initial power, maximum power and cooling. The power regulation could be adjusted according to the microwave absorption level of the reaction mixture and was set to “very high” in all PCR experiments. Cooling was performed with compressed air of room temperature. It should be noted that the efficiency is somewhat dependent on the temperature of the air, and shorter or longer cooling times can come in question.
All PCR reactions were conducted using 160 nM Frw (AGACCTTGGGATACTGCACGG) and Rew (CCATTCCACAGCCTGGCACT) primers, 320 µM dNTP, 20 ng/µL BSA, Taq polymerase, and human genomic DNA (Boehringer Mannheim, Germany) in a buffer of 2.9 mM MgCl2, 50 mM KCl and 10 mM Tris-HCl, pH 8.3. Real-time PCR quantification of the amount of human genomic DNA added revealed that around 10 000 copies of the target sequence were added per reaction. The amplified sequence is a 53 bp fragment from the human chromosome 13.
2.5 mL Microwave-assisted PCR:
The 2.5 mL reaction mixture and a magnetic stirring bar were added to a 2.0-5.0 mL process vial. The vial was sealed with a septum and positioned into the microwave cavity. The microwave instrument was programmed to heat for 45 s at 90 ºC and 175 W initial power, cool for 50 s and finally heat for 85 s at 60 ºC with 15 W maximum power during the very first thermocycle. The 32 subsequent thermocycles were programmed to heat for 35 s at 88 ºC, cool for 50 s and heat at 60 ºC for 85 s with 15 W as maximum power. The resulting temperature profiles are depicted in Figure 1. The overall process time was 1 h and 34 min. Duplicates were prepared, amplified and analyzed (see Figures 3 and 4). One negative control with buffer without gDNA was treated with the same procedure.
Fluoroptical temperature readings:
The fluoroptical measurement instrument was a Nortech GC68A006 provided by Fibronic inc. The instrument was calibrated at three points – boiling pure water (100 ºC), boiling dry tetrahydrofuran (67 ºC) and a temperature cell with a crystallizing compound (26.65 ºC). The instrument measurements had to be corrected with the equation Tactual = 0.9757 Treading + 0.8145.
The fluoroptical probe was inserted into the 2.0-5.0 mL process vial through a drilled hole in the security lid and a punched hole in the vial septa. The probe was introduced after the heating started, thus there is no readings from the fluoroptical probe during the first heating cycle in Figure 1, showing the simultaneous readings from the fluoroptical probe and the infrared pyrometer.
15 mL Microwave-assisted PCR:
The 15 mL reaction mixture and a magnetic stirring bar were added to a 10-20 mL process vial. The vial was sealed with a septum and positioned into the microwave cavity. The microwave instrument was programmed to heat for 60 s at 90 ºC and 300 W initial power, cool for 80 s and finally heat for 85 s at 60 ºC with 15 W maximum power during the first thermocycle. The settings for the successive second cycle were 50 s of heating at 88 ºC, 80 s of cooling and 85 s of heating at 60 ºC with 15 W maximum power. It was shown that the cooling time was not sufficiently long, thus the cooling step was prolonged to 90 s in the third cycle. To ensure good cooling and a stable temperature at 60 ºC the cooling period was extended with 5 additional seconds in the 30 subsequent thermocycles. The sample was prepared, amplified and
analyzed (see Figures 3 and 4). The resulting IR-temperature curve is presented in Figure 2. The overall process time was 2 h and 7 min.
Agarose gel-electrophoresis:
Samples were withdrawn from completed microwave-assisted PCR mixtures. Together with a G-50 purified PCR product obtained using traditional heating the samples were applied to a 4% agarose gel containing ethidiumbromide. For reference two ladders, 50 bp and 100 bp, were used. After electrophoresis the gel was UV-illuminated and a photograph was taken, Figure 3, (inversed colors). The samples were as follows; Lane 1: G-50 purified PCR product. Lane 2 and 4: PCR sample from two independent 2.5 mL microwave-assisted PCRs. Lane 3: PCR sample from a negative control reaction using microwave-assisted PCR were no genomic DNA had been added to the PCR mixture. Lane 5: A sample from the 15 mL microwave-assisted PCR was loaded. The difference in intensity between the products loaded in Lane 2 and 4 corresponds to a difference in amplification efficiency of 96% and 92% respectively (Table 1).
Figure 3. Analysis of Microwave Heated PCR by Ethidiumbromide Stained 4% Agarose Gel
Capillary electrophoresis:
For enhanced size determination and to quantify the amount of obtained PCR product all reactions were run on an Agilent BioAnalyzer 2100 using the DNA1000 chip-kit. In Table 1 the average results from two runs are presented for each sample. The corresponding electropherograms can be seen in Figure 4A-D. The first and last peaks in each electropherogram are internal markers used for calibration and normalization between samples. Graph A is from 2.5 mL microwave-assisted PCR sample 1 (Figure 3, Lane 2), B from 2.5 mL microwave-assisted PCR without gDNA added (no PCR product-peaks detected, Figure 3, Lane 3), C from 15 ml microwave-assisted PCR (Figure 3, Lane 5) and D is a DNA ladder used for size determination and quantification of the samples. Based on the capillary electrophoresis results, an estimation of amplification efficiency was calculated for each reaction (Table 1).
Table 1
Sample Lane Size (+/-5 bp) Amount (ng/µl) Conc. (nM) Amplification(%)
2.5 mL Microwave-PCR 2 510.9427 96
2.5 mL Microwave-PCR 4 510.31 9 92
15 mL Microwave-PCR 5 521.0*29approaches 100
G-50 purified PCR product 530.175 5 NA
* A smaller band, around 43 bp, were found to be present at 0.34 ng/µl. This is most likely a primer-dimer product, total amount of product was thus 1.34 ng/µl.
Figure 4A-D. Normalized Electropherograms From Bioanalyzer DNA Chip
A) 2.5 mL Microwave-PCR (Lane 2)
B) No Template 2.5 mL Microwave-PCR (Lane 3)
C) 15 mL Microwave-PCR (Lane 5)
D) Reference DNA Ladder for Quantification and Size-Determination
Real-time PCR with traditional heating:
Samples were diluted a hundred thousand times in pure water and 2.5 µL of the diluted sample was added to 22.5 µL PCR mixture containing the same concentration of reagents as in the microwave experiment but with the addition of SYBR Green (Molecular Probes). The thermocycling program used were 95 °C for 15 seconds followed by 60 °C for 60 seconds for 40 cycles followed by a melting curve. The latter to ensure that correct product had been formed. A dilution series of purified PCR product was utilized to construct a standard curve which was employed for quantification of product from the microwave-assisted PCR (Figure 5). Presented in Table 2 are the averages of three independent real-time PCR reactions for each sample (ABI 7000). Using the formula obtained from the standard curve the amount of molecules put into the reaction was calculated. Knowing that the initial amount of starting material was 10000 copies, the amount of amplification after 33 cycles were also calculated. Based on formula [1], the amplification efficiencies of the different reactions were calculated. No account has been taken to the possibility that the reactions have reached plateau-phase before 33 cycles. If so, the real amplification-efficiency during exponential-phase will be higher than the number we report here. In order to determine this, however, analysis of amount product after different number of microwave-assisted PCR cycles has to be performed. The results obtained using real-time PCR analysis correlates well, albeit slightly lower yields are detected than when using direct detection with capillary electrophoresis.
[1]Yield = Starting amount (1 + amplification efficiency)number of cycles
Figure 5. Real-Time PCR of a Dilution Series of Purified PCR Product
.
Table 2
Sample LaneCtMolecules AmplificationEfficiency
2.5 mL Microwave- PCR 219.65 0.462207122.21109 92%
2.5 mL Microwave- PCR 420.96 0.34841878.42108 86%
15 mL Microwave- PCR 518.35 0.315702265.7109 98%
1