1. DNA Might Be Degraded Or Damaged If It Exited the Nucleus
Page 241 #1-13
Pg 253 #1-9
Page 241
1. DNA might be degraded or damaged if it exited the nucleus.
2. DNA à (transcription) à mRNA à (translation) à protein
3. deoxyribose has an H at the 2’ carbon, while ribose has a hydroxyl group at the 2’
4. mRNA: product of transcription.
tRNA: delivers AA’s to the ribosome
rRNA: structural of component with ribosomes, along with RNA proteins
5.
Similarities / Differences· nucleic acids
· polymers
· contain adenine, guanine, cytosine / · RNA is single-stranded
DNA is double-stranded
· RNA backbone: ribose + phosphate
DNA backbone: deoxyribose + phosphate
· RNA has uracil; DNA has thymine
· DNA in nucleus only; RNA in nucleus + cytoplasm
6.
Transcription / TranslationLocation / Nucleus / Cytoplasm
Purpose / Copy a DNA sequence (gene) into a template for protein synthesis / Use mRNA template to build the specified protein
Outcome / mRNA / Protein
7.
Transcription / TranslationInitiation / RNA Pol binds to the promoter and starts the process / Ribosome recognizes a start codon and initiation complex assembles
Elongation / RNA Pol uses DNA template to synthesize a complementary mRNA strand / Ribosome builds polypeptide using mRNA as template. It moves along the mRNA, reading codons which direct elongation
Termination / RNA Pol ceases transcription upon reaching terminator sequence / Ribosome reaches a stop codon; falls off strand and releases polypeptide
8. Pairs would give 4^2 = 16 possible combinations à insufficient to encode all 20 amino acids.
9. Stop codon: Tells ribosome to stop translation. There are three of them.
Start codon: Tells ribosome to start translation; there is only one (AUG) which also codes for methionine. The first A.A. incorporated is therefore always methionine.
10. CCUAUCCCCAGGUCCGUUAAAUCGUACGGGGUU
11. MET-GLY-HIS-TYR-PHE-ALA-ARG-CYS-GLY-GLY-ALA-stop
12.4^3 is insufficient therefore try one more.
4^4 = 256 = sufficient. Each codon must be 4 nucleotides long.
13. 5 A.A.s x 3 nucleotides/codon = 15 nucleotides required
You could also take into account that a start and stop codon are required à
21 nucleotides are required
Page 254
1. a. A site is where the incoming tRNA brings the new amino acid. P site is where the peptide bond is formed between adjoining amino acids on the growing polypeptide chain
b. codon is a triplet of nucleotides of mRNA that encodes a single amino acid.
Anticodon is triplet of nucleotides on tRNA that recognizes and pairs with a codon on the mRNA.
c. start codon tells ribosome to start. Always AUG = methionine. Stop codon tells ribosome to stop translation; three stop codons UGA, UAG, UAA.
2. mRNA, tRNA, rRNA – I am not explaining this one again
3. Note the questions asks for ANTICODONS
AA / Possible codon / Possible anticodonThr / ACU
ACC
ACA
ACG / UGA
UGG
UGU
UGC
Ala / GCU
GCC
GCA
GCG / CGA
CGG
CGU
CGC
Pro / CCU
CCC
CCA
CCG / GGA
GGG
GGU
GGC
4. redundancy of the genetic code.
Many codons will code for the same AA – usually the third AA of the codon differs.
Ex. Proline encoded by CCU, CCC, CCA, CCG
5. to honest I didn’t read the question carefully before I assigned it – I wont ask you one like this
6. Met-pro-Pro-Gly-Lys-Asp-Stop
7. Methionine starts at the P site – it never enters at the A site
8. The ribosome recognizes the 5’ cap in eukaryotic mRNA (or the Shine-DAlgarno sequence in prokaryotes) and initiation complex assembles around the start codon. The complex consists of: the small ribosomal subunit, the tRNA carrying Methionine (at the P site) and the large ribosomal subunit. The next codon is read and the corresponding AA is brought to the A site by a tRNA. The ribosome moves along the mRNA in triplets of three nucleotides, termed codons. Each codon encodes one amino acid, which is brought to the A site by appropriate tRNA’s. As the ribosome moves down the strand, the tRNA that was previously in the A site is shifted into the P site, where a peptide bond is formed between the AA on the tRNA, and the growing polypeptide chain. Once the ribosome reaches a stop codon, it terminates translation and disassembles.
9. Translation = Expressing the same information in another language
Genetic translation involves taking the information of mRNA and transferring that to an amino acid sequence.