Yamamoto et al., Particle size distributions and seasonal
diversity of allergenic and pathogenic fungi in outdoor air
Supplementary Figure 1Rarefaction curves of observed fungal OTUs by particle aerodynamic diameter (da) and season. OTUs are based on 97% similarity.
Supplementary Figure 2Relative abundances of allergenic and infectious pathogenic fungal species by season. The allergenic (in red) and pathogenic (underlined) species are defined as those listed in SupplementaryTables 3 and 4, respectively.
Supplementary Figure 3Relative abundances of known allergenic and pathogenic species in each major fungal genus. The abundances are averaged over all particle sizes and seasons. The allergenic (in red) and infectious pathogenic (underlined) species are defined based on the lists of allergenic and pathogenic fungi in Supplementary Tables 3 and 4, respectively.
S1
Yamamoto et al., Particle size distributions and seasonal
diversity of allergenic and pathogenic fungi in outdoor air
Supplemental Table 1 Summary statistics of meteorological conditions
Spring / Summer / Fall / WinterSampling period / Start / 15:30
May 13, 2009 / 10:45
Aug 11, 2009 / 11:00
Oct 15, 2009 / 11:00
Jan 14, 2010
End / 10:30
Jun 10, 2009 / 10:30
Sep 8, 2009 / 11:00
Nov 12, 2009 / 10:30
Feb 11, 2010
Temperature (C°)a / Mean / 16 / 23 / 10 / 0
Max. of daily average / 21 / 28 / 17 / 8
Min. of daily average / 12 / 17 / 4 / -9
Max. of hourly average / 28 / 32 / 21 / 13
Min. of hourly average / 5 / 12 / -3 / -13
Relative humidity(%)a / Mean / 72 / 75 / 74 / 63
Max. of daily average / 95 / 89 / 92 / 93
Min. of daily average / 47 / 59 / 48 / 39
Max. of hourly average / 100 / 97 / 100 / 100
Min. of hourly average / 24 / 37 / 36 / 24
Wind velocity (m/sec) a / Mean / 2.4 / 2.2 / 3.2 / 3.3
Max. of daily average / 4.0 / 4.6 / 7.0 / 7.0
Min. of daily average / 1.0 / 0.8 / 0.2 / 0.9
Max. of 5 second speed / 14.3 / 11.6 / 16.1 / 24.1
Max. of 2 minute speed / 10.7 / 9.4 / 12.5 / 17.0
Precipitation (mm/day) a / Mean / 3.59 / 1.09 / 4.17 / 1.51
a The original data were obtained from the National Climatic Data Center of the National Oceanic and Atmospheric Administration ( The data obtained at the Tweed New Haven Airport Station(41°15'50"N 72°53'12"W) were used.
Supplemental Table 2 Sequences of primers and probes used for qPCR assays
Assay name / Fungal species / Primer (probe) name / Sequence5’-3’ / MethodAaltr a / Alternaria alternata / AaltrF1 / GGCGGGCTGGAACCTC / TaqMan
AltrR1-1 / GCAATTACAAAAGGTTTATGTTTGTCGTA
AaltrP1 / TTACAGCCTTGCTGAATTATTCACCCTTGTCTTT
Afumia / Aspergillus fumigatus,
Neosartorya fischeri / AfumiF1 / GCCCGCCGTTTCGAC / TaqMan
AfumiR1 / CCGTTGTTGAAAGTTTTAACTGATTAC
AfumiP1 / CCCGCCGAAGACCCCAACATG
Cclad2a / Cladosporium cladosporioides, svar. 2 / Cclad2F1 / TACAAGTGACCCCGGCTACG / TaqMan
CcladR1 / CCCCGGAGGCAACAGAG
CcladP1 / CCGGGATGTTCATAACCCTTTGTTGTCC
Enigra / Epicoccum nigrum / EnigrF1 / TTGTAGACTTCGGTCTGCTACCTCTT / TaqMan
EnigrR1 / TGCAACTGCAAAGGGTTTGAAT
EnigrP1 / CATGTCTTTTGAGTACCTTCGTTTCCTCGGC
PenGrp3a / Penicilliumchrysogenum/griseofulvum/glandicola/coprophilum/expansum
and Eupenicillium / PchryF1 / CGGGCCCGCCTTAAC / TaqMan
PchryR1-1 / GAAAGTTTTAAATAATTTATATTTTCACTCAGAGTA
PenP2 / CGCGCCCGCCGAAGACA
PenAsp1mgba / Universal Penicillium, Aspergillus
and Paecilomyces varioti / PenAspF1 / CGGAAGGATCATTACTGAGTG / TaqMan
PenAspR1 / GCCCGCCGAAGCAAC
PenAspP1mgb / CCAACCTCCCACCCGTG
ITS1F/ITS4b / Universal fungi / ITS1F / Adaptor A-Key-MID-CTTGGTCATTTAGAGGAAGTAA / Pyrosequencing
ITS4 / Adaptor B-Key-TCCTCCGCTTATTGATATGC
aHaugland and Vesper (2002).
bLarena et al.(1999); Manter and Vivanco,(2007).
S1
Yamamoto et al., Particle size distributions and seasonal
diversity of allergenic and pathogenic fungi in outdoor air
Supplemental Table 3List of allergenic fungi (Simon-Nobbe et al., 2008)
Allergenic fungiAscomycota / Alternaria porri / Penicillium chrysogenum
Alternaria alternata / Alternaria pseudorostrata / Penicillium notatum
Alternaria argyranthemi / Alternaria radicina / Penicillium citrinum
Alternaria brassicicola / Alternaria solani / Penicillium oxalicum
Alternaria blumeae / Alternaria smyrnii / Pleospora herbarum
Alternaria brassicae / Alternaria sonchi / Stemphylium botryosum
Alternaria capsici / Alternaria tagetica / Saccharomyces cerevisiae
Alternaria carotiincultae / Alternaria tenuissima / Stachybotrys chartarum
Alternaria cetera / Aspergillus flavus / Stemphylium callistephi
Alternaria cheiranthi / Aspergillus fumigatus / Stemphylium vesicarium
Alternaria cinerariae / Aspergillus nidulans / Thermomyces lanuginosus
Alternaria conjuncta / Aspergillus niger / Trichophyton mentagrophytes
Alternaria crassa / Aspergillus oryzae / Trichophyton rubrum
Alternaria cucumerina / Beauveria bassiana / Trichophyton schoenleinii
Alternaria dauci / Candida albicans / Trichophyton tonsurans
Alternaria dumosa / Candida boidinii / Ulocladium alternariae
Alternaria eryngii / Cladosporium herbarum / Ulocladium atrum
Alternaria ethzedia / Cladosporium cladosporioides / Ulocladium botrytis
Alternaria euphorbiicola / Curvularia lunata / Ulocladium chartarum
Alternaria japonica / Embellisia allii / Ulocladium cucurbitae
Alternaria limoniasperae / Embellisia indefessa
Alternaria longipes / Embellisia novae-zelandiae / Basidiomycota
Alternaria macrospora / Embellisia telluster / Coprinus comatus
Alternaria metachromatica / Epicoccum purpurascens / Malassezia furfur
Alternaria mimicula / Epicoccum nigrum / Malassezia sympodialis
Alternaria mouchaccae / Fusarium culmorum / Psilocybe cubensis
Alternaria oregonensis / Fusarium solani / Rhodotorula mucilaginosa
Alternaria petroselini / Nimbya caricis
Alternaria photistica / Penicillium brevicompactum
Supplemental Table 4 List of pathogenic fungi (Makimura, 2001)
Pathogenic fungi aAscomycota / Issatschenkia orientalis / Cryptococcus neoformans
Ajellomyces capsulatus / Madurella grisae / Filobasidiella neoformans
Ajellomyces dermatitidis / Microsporum canis / Schizophyllum commune
Arthroderma benhamiae / Microsporum fulvum / Trichosporon asahii
Arthroderma fulvum / Microsporum gypseum / Trichosporon cutaneum
Arthroderma gypseum / Nectria haematococca / Trichosporon inkin
Arthroderma incurvatum / Paecilomyces variotii / Trichosporon mucoides
Arthroderma otae / Paracoccidioides brasiliensis
Arthroderma vanbreuseghemii / Penicillium marneffei / Zygomycota
Aspergillus flavus / Pichia anomala / Absidia corymbifera
Aspergillus fumigatus / Pichia guilliermondii / Cunninghamella sp.
Aspergillus niger / Pneumocystis carinii / Mucor circinelloides
Blastomyces dermatitidis / Pseudallescheria boydii / Rhizopus oryzae
Candida albicans / Scedosporium apiospermum
Candida glabrata / Sporothrix schenckii
Candida guilliermondii / Trichophyton mentagrophytes
Candida krusei / Trichophyton rubrum
Candida parapsilosis / Trichophyton verrucosum
Candida tropicalis / Trichophyton violaceum
Candida pelliculosa
Cladophialophora carrionii / Basidiomycota
Coccidioides immitis / Malassezia furfur
Epidermophyton floccosum / Malassezia globosa
Exophiala dermatitidis / Malassezia obtusa
Fonsecaea pedrosoi / Malassezia pachydermatis
Fusarium solani / Malassezia restricta
Geotrichum candidum / Malassezia slooffiae
Histoplasma capsulatum / Malassezia sympodialis
Hortaea werneckii / Rhodotorula rubra
a The fungal species are selected from the Alphabetical List of Pathogenic Fungi ver.1.2.7. in Pathogenic Fungi Database ver. 1.9.6.1 (
S1
Yamamoto et al., Particle size distributions and seasonal
diversity of allergenic and pathogenic fungi in outdoor air
Supplemental Table 5Summary statistics of fungi ITS sequences
Season / Aerodynamic diameter, da(μm) / Number of sequences / Number of sequences determined to each taxonomic level (no. of taxa identified)Phylum / Class a / Ordera / Genus / Species
Spring / >9.0 / 831 / 824 (2) / 724 (11) / 658 (34) / 556 (119) / 476 (145)
5.8-9.0 / 766 / 766 (2) / 718 (11) / 698 (29) / 584 (105) / 542 (144)
4.7-5.8 / 739 / 737 (2) / 696 (11) / 676 (28) / 610 (100) / 576 (132)
3.3-4.7 / 677 / 677 (2) / 662 (7) / 595 (21) / 547 (81) / 510 (102)
2.1-3.3 / 433 / 433 (2) / 420 (7) / 351 (15) / 319 (64) / 296 (80)
Summer / >9.0 / 664 / 664 (2) / 658 (9) / 651 (20) / 588 (54) / 535 (68)
5.8-9.0 / 918 / 918 (2) / 906 (13) / 881 (34) / 737 (149) / 633 (186)
4.7-5.8 / 955 / 948 (2) / 934 (12) / 916 (32) / 780 (151) / 689 (203)
3.3-4.7 / 518 / 517 (2) / 515 (8) / 494 (22) / 423 (106) / 372 (137)
2.1-3.3 / 315 / 315 (2) / 314 (8) / 291 (17) / 268 (79) / 237 (99)
Fall / >9.0 / 875 / 874 (2) / 840 (10) / 712 (27) / 661 (100) / 522 (127)
5.8-9.0 / 749 / 739 (2) / 703 (10) / 655 (32) / 587 (142) / 465 (201)
4.7-5.8 / 501 / 500 (2) / 485 (10) / 475 (28) / 439 (121) / 384 (168)
3.3-4.7 / 777 / 774 (2) / 762 (11) / 751 (26) / 729 (124) / 627 (180)
2.1-3.3 / 311 / 310 (2) / 309 (7) / 299 (15) / 294 (56) / 280 (64)
Winter / >9.0 / 487 / 482 (2) / 454 (10) / 423 (34) / 363 (101) / 306 (138)
5.8-9.0 / 916 / 914 (2) / 817 (10) / 802 (35) / 764 (130) / 665 (174)
4.7-5.8 / 2062 / 2062(2) / 1983 (12) / 1970 (26) / 1895 (68) / 1593 (90)
3.3-4.7 / 893 / 893 (2) / 885 (8) / 866 (26) / 837 (76) / 742 (101)
2.1-3.3 / 939 / 938 (2) / 935 (9) / 897 (19) / 883 (63) / 830 (77)
Total / - / 15326 / 15285 (2) / 14720 (19) / 14061 (68) / 12864 (558) / 11280 (1172)
aFungi that are categorized as incertae sedisat these taxonomic levels are excluded from counting the numbers of identified taxa.
S1
Yamamoto et al., Particle size distributions and seasonal
diversity of allergenic and pathogenic fungi in outdoor air
Supplemental Table 7Diversity parameters for sampled atmospheric fungi based on 97% OTU similarity
Season / Aerodynamic diameter, da(μm) / Number of observed OTUs / Chao1 / Shannon indexSpring / > 9.0 / 336 / 2387 / 6.7
5.8-9.0 / 300 / 1686 / 7.4
4.7-5.8 / 368 / 1983 / 7.6
3.3-4.7 / 374 / 1942 / 7.7
2.1-3.3 / 173 / 908 / 6.7
Summer / > 9.0 / 203 / 746 / 6.0
5.8-9.0 / 385 / 2482 / 6.9
4.7-5.8 / 544 / 4273 / 8.0
3.3-4.7 / 268 / 2662 / 7.0
2.1-3.3 / 194 / 2044 / 7.1
Fall / > 9.0 / 256 / 5157 / 5.2
5.8-9.0 / 359 / 3320 / 6.8
4.7-5.8 / 280 / 1650 / 7.4
3.3-4.7 / 545 / 3579 / 8.7
2.1-3.3 / 195 / 1010 / 7.4
Winter / > 9.0 / 185 / 892 / 6.8
5.8-9.0 / 418 / 1563 / 7.7
4.7-5.8 / 350 / 808 / 6.0
3.3-4.7 / 283 / 1086 / 7.1
2.1-3.3 / 358 / 1117 / 7.5
Supplementary References
Haugland R, Vesper S (2002). Method of identifying and quantifying specific fungi and bacteria. U.S. Environmental Protection Agency: USA.
Larena I, Salazar O, Gonzalez V, Julian MC, Rubio V (1999). Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. JBiotechnol75: 187-194.
Makimura K (2001). Alphabetical List of Pathogenic Fungi Ver.1.2.7. Pathogenic Fungi Database (PFDB) Ver. 1.9.6.1.
Manter DK, Vivanco JM (2007). Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. J Microbiol Meth71: 7-14.
Simon-Nobbe B, Denk U, Poll V, Rid R, Breitenbach M (2008). The spectrum of fungal allergy. Int Arch Allergy Immunol 145: 58-86.
S1