Supplemental fIGURE lEGENDS
Figure S1. Coomassie blue-stained SDS-PAGE of recombinant human CRBN-DDB1 complex purification. Fractions from the last purification step, namely gel filtration on a Sephacryl S-200 HR, (as described in Supplementary Methods) were analyzed by SDS-PAGE. DDB1/CRBN fractions were pooled,concentrated to 15-20 mg protein/ml, and stored at -70 ºC. This recombinant human DDB1/CRBN complex was used in the thermal melt binding studies.
Figure S2. CRBN immunoblot and CRBN 65-76 peptide antibody specificity analysis. (a) CMV vector control (CMV) and plasmid containing FLAG-tagged CRBN were expressed in HEK293T cellsand CRBN detected by immunoblot as described in Supplementary Methods (b)Specificity of the CRBN signal was confirmed by incubation with the 65-76 blocking peptide to which the antibody was raised . (C) Protein lysates from U266 cells treated with control siRNA or two siRNAs against CRBN were analyzed by immunoblot using anti-CRBN and anti-β-actinantibodies. Upper panel was incubated with anti-CRBN antibody and anti-β-actin; in lower panel where indicated lysates were incubated with anti-CRBN and CRBN 65-76 blocking peptide and anti-β-actin. For HEK293T overexpression studies an anti-CRBN monoclonal antibody was generated in mice against amino acids 1-18 of human CRBN. The antibody cross-reacts with mouse and rat CRBN.
sUPPLEMENTAL Methods
CRBN antisera production, validation, immunoblot and immunofluorescence analyses
CRBN antiserum was generated in a rabbit against the peptide sequence of 65-76 of human CRBN and CRBN specificity determined with peptide blocking experiments and siCRBN experiments (Supplementary Fig. 2). Anti-CRBN monoclonal antibody was generated in mice against amino acids 1-18 of human CRBN. Other antibodies used were commercially available; DDB1 (1:2000; Invitrogen), p21 (1:1000; Cell Signaling), β-actin (1:10,000: Sigma), FLAG (M2, Sigma), HA (3F10, Roche) and c-myc (Cell Signaling Technologies).
For immunoblot analyses,cells were harvested and lysed in Chris buffer (50 mM Tris pH8, 200 mM NaCl, 10% Glycerol, 0.1 mM EDTA) containing complete EDTA-free protease inhibitor cocktail tablets (Roche), PhosStop phosphatase inhibitor cocktail tablets (Roche) and 20mM PNPP (Sigma). Protein concentration was determined using a 9-point standard curve with Bio-Rad Protein Assay reagent and the tunable VERSAmax microplate reader (Molecular Devices). Cell extracts (50 μg protein) were loaded onto Criterion XT-Precast 4-12% Bis-Tris gels (Bio-Rad) using NuPAGE MES SDS running buffer (Invitrogen). Protein was transferred onto Nitrocellulose Criterion Blotting Sandwiches (Bio-Rad) using NuPAGE Transfer Buffer (Invitrogen) containing 15% ethanol. Standard protocols for signal detection using the LI-COR Odyssey imager and software were applied.For immunoflorescence confocal microscopy analyses, cells were fixed in acetone:methanol mix (1:1) and stained with rabbit anti-hCRBN antibody in BD Perm/Wash buffer followed by Alexa Fluor 488-conjugated anti-rabbit (Biolegend) and then nuclear dye DRAQ5 (Invitrogen). For blocking peptide experiments CRBN 65-75 peptide sequence was preincubated with antisera at a 10-fold excess concentration. Images were acquired with Nikon E-800 fluorescent confocal microscope at 60 x final magnification. Images were analyzed with Metamorph software (Molecular Devices, a Danaher subsidiary) and processed with Adobe Photoshop software (Adobe).
Cloning, expression and purification of human CRBN and DDB1
The cDNAs for the CRBN and DDB1 genes were amplified by PCR using Pfusion (NEB) as the polymerase and the following primer sequences: CRBN-Forward (GTGCCGCGTGGCTCCATGGCCGGCGAAGGAGATCAGCAGGA), CRBN-Reverse (GCTTCCTTTCGGGCTTATTACAAGCAAAGTATTACTTTGTC), DDB1-Forward (TCGGGCGCGGCTCTCGGTCCGAAAAGGATGTCGTACAACTACGTGGTAAC), DDB1-Rev (GCTTCCTTTCGGGCTTATTTTTCGAACTGCGGGTGGCTCCAATGGATCCGAGTTAGCTCCT) and CRBN-Flag-Reverse (GCTTCCTTTCGGGCTTACTTATCGTCATCGTCCTTGTAGTCCAAGCAAAGTATTACTTTGT) CRBN was cloned into pBV-ZZ-HT-LIC, pBV-GST-LIC, pMA-HT-LIC, and DDB1 into pBV-notag-LIC, using ligation-independent cloning 26. For cloning into the mammalian vector pMA-HT-LIC, the CRBN-Flag-Reverse oligo adds a C-terminal FLAG tag for immunodetection. The DDB1-Rev adds a StrepTag 27. A ZZ-tag 28 was necessary to achieve high expression of soluble CRBN; without it, the His-CRBN expressed at low level, while a GST-CRBN was resulted in aggregated protein. Recombinant baculovirus of ZZ-His-CRBN and DDB1-StrepTag (ST) were generated and amplified using Bac-to-Bac baculovirus expression system from Invitrogen in Sf9 insect cells. ZZ-His-CRBN and DDB1-ST were co-expressed in High Five (Tni) insect in 10L wave bags at 27 ºC using un-supplemented ESF921 media from Expression Systems. Cells were harvested 48 hours post infection by centrifugation and paste was re-suspended in PBS plus5X Protease Inhibitor cocktail (Roche, Indianapolis, IN).
All subsequent protein purification steps were carried out at 4 ºC. Frozen cells were thawed, resuspended in 5 volumes of lysis buffer (50 mM Tris HCl pH 8.0, 0.5 M NaCl, 10% glycerol, 2 mM DTT ) plus 20 mM imidazole and protease inhibitors, lysed and centrifuged to yield a clear supernatant. The CRBN-DDB1 was purified on a ÄKTA-xpress system (GE Healthcare) using a Nickel-Sepharose and S200 Sephacryl chromatography. The complex was then further purified using anion exchange chromatography on an 8 ml MonoQ column and a second pass on a S-200 gel filtration. CRBN-DDB1 was identified by SDS-PAGE and the CRBN-DDB1 containing fractions were pooled and stored at -70 ºC (Supplementary Fig. 1).
Small interfering RNA (siRNA) and short hairpin (shRNA) CRBN genetic reduction studies
siRNA and shRNA knockdown were used to genetically inhibit CRBN gene expression. The U266 myeloma cell line was transfected with siRNAs targeting CRBN and human non-targeting scrambled control siRNAs (Dharmacon and Invitrogen) at a final concentration of 10, 25 or 50 nM using the Cell Line Nucleofector Kit V and program X-001 (Amaxa Biosystems). Efficacy of siRNA oligonucleotides at multiple doses was established. The transfection with non-targeting siRNA was used as control. Immunoblot (CRBN 65-75 antisera) was used to measure CRBN protein expression. siRNAs used in this study were siCRBN-1 (5’-CAGCUUAUGUGAAUCCUCAUGGAUA-3’) and siCRBN-7 (5’-AAGUGUCUCAUGCACAUAUCCAUGA-3’) all obtained from Invitrogen.
Lentivirus plasmid expressing shRNA against human CRBN (CRBN-shRNA (5’-TGACAAGTACATGTTCCT-3’) was purchased from OpenBiosystems. The shRNA plasmids were transfected into HEK293T cells for lentivirus packaging. The lentivirus-containing supernatants were harvested post transfection after 72 hours, spun down, filtered and stored at 4ºC. U266 cells were treated with shCRBN for 72 hr. Polybrene was added to lentivirus-containing supernatants to increase U266 cells infection efficiency. For generation of stable cell lines, U266 cells were infected as described above and grown in the medium containing puromycin for two weeks. Clonal cell lines were established by limiting dilution. Limiting dilution cultures were set up using at least 1000 replicates at a mean cell concentration of 0-3 cell/well from shCRBN bulk cultures in presence of “feeder uninfected parental cells” at a 100 feeder cells per 1 shCRBN cell ratio. After two weeks, limiting dilution cultures were grown in medium containing puromycin to eliminate feeder cells. Knockdown of endogenous CRBN was evaluated by quantitative real-time reverse transcription-PCR and immunoblot for CRBN.