The diversity and fitness effects of infection with facultative endosymbionts in the grain aphid, Sitobion avenae
Piotr Łukasik1*, Maciej A. Dawid1, Julia Ferrari1,2, and H. Charles J. Godfray1
1Department of Zoology, University of Oxford, Oxford, United Kingdom
2Department of Biology, University of York, York, United Kingdom
*Correspondence to: .
Electronic Supplementary Material
Methods and Results – Aphid susceptibility to parasitoids: The effects of aphid symbionts on parasitoid development
In one of the blocks of the first susceptibility experiments,all parasitoid mummieswere transferred singly to gelatine capsules within 24 hours of formation. Capsules were then monitored every 12 hours and the sex and development time of each emerging wasp noted.The wasps were then placed in a desiccator for at least 7 days at 50°C and weighed on an AD-4 microbalance (Perkin-Elmer Inc.) to an accuracy of 0.1 µg.
The mean rate of successful emergence of Aphidius ervi and Ephedrus plagiator from pupae collected in the first block of the first susceptibility experiment was 97.2% and 94.5%, respectively, with no differences in the emergence rate between aphid genotypes or between infected versus uninfected lines (in all cases, p > 0.25). Among 404 emergingA. ervi, the mean proportion of females was 41.8%, and among 377 E. plagiator it was 50.2%, with no significant differences between host genotypes or symbiont infection statuses in either species (in all cases, p > 0.60). The development times of parasitoids differed considerably between wasp species and sexes, but in neither sex of either A. ervi or E. plagiator were they significantly affected by aphid genotype or by the presence of symbionts (in all cases, p > 0.20). The effect of Hamiltonella infection on the size of emerging A. ervifemales varied significantly across aphid genotypes (genotype × symbiont interaction: F3, 177= 4.77, p = 0.003 for females), but the effect of symbiont alone was not significant (F1, 178= 1.87, p = 0.17; Figure S2). According to Tukey’s HSD test, Hamiltonella infection in host aphids had a significant negative effect on the size of parasitoid females in three of the four host aphid genotypes, but a positive effect in the fourth. The size of emerging A. ervi males was not significantly affected by Hamiltonella infection in host aphids, with no differences between aphid genotypes (p > 0.15). In contrast, in E. plagiator host infection with Hamiltonella had a significantly negative effect on the size of females (F1, 182= 5.93, p = 0.016), while it tended to lead to an increase in the size of males (F1, 184= 3.72, p = 0.055). There were no differences in the effects of Hamiltonellaon E. plagiatorsize across aphid genotypes (p > 0.35; Figure S2).
Methods and Results – Parasitoid oviposition behaviour
We studied the behaviour of naïve parasitoids simultaneously offered infected and non-infected aphids. Third instar (96-108 hours old) aphids from each line were transferred to a Petri dish and allowed to settle on small pieces of Triticum leaves. Two sections of leaves, each with four aphids feeding within a body’s length of each other, were placed next to each other in a transparent arena 4mm high and of 45mm diameter. One leaf section had infected and the other uninfected aphids. Parasitoid females were introduced to the Petri dish and the number of contacts with infected and non-infected aphids before the first oviposition attempt, as well as the sequence of oviposition attempts, were recorded. We also made notes on the aphids’ behaviour, particularly on the production of cornicle secretions and their tendency to walk away from the leaf. The observations were continued until either the majority of aphids from both lines started dispersing and the two groups became mixed and indistinguishable, or the parasitoid stopped searching and had no contact with the aphids for a period of five minutes. The behaviour of 52 naïve A. ervi females was observed in this way.
Our observations did not indicateparasitoid behavioural bias towards any of the aphid lines, nor differences in the defensive behaviour of the aphids. The probability that the first aphid to be attacked carried a symbiont was not significantly different from 0.5 (χ2 = 0.02, d.f. = 1, p = 0.88) and the proportion of Hamiltonella-infected aphids among all attacked aphids did not differ significantly from 0.5 (χ2 = 0.19, d.f. = 1, p = 0.66). Following parasitoid attack, but also in response to alarm pheromone released with droplets of cornicle secretion by nearby aphids, the experimental aphids displayed defensive behaviours which included kicking, production of cornicle secretion and dispersal. We observed no differences in the frequency of these behaviours between infected and non-infected lines.
Name / Sequence (5’-3’) / Used with... / Gene / Description / Reference10F / AGTTTGATCATGGCTCAGATTG / 35R, diagnostic / 16S / Universal eubacterial primer / Sandstrom et al 2001
35R / CCTTCATCGCCTCTGACTGC / 10F / 23S / Universal eubacterial primer / Russell & Moran 2005
1507R / TACCTTGTTACGACTTCACCCCAG / for sequencing / 16S / Universal eubacterial primer / Sandstrom et al 2001
T419R / AAATGGTATTSGCATTTATCG / 10F / 16S / Diagnostic - Hamiltonella-specific / Ferrari et al 2012
U443R / GGTAACGTCAATCGATAAGCA / 10F / 16S / Diagnostic - Regiella-specific / Ferrari et al 2012
R443R / CTTCTGCGAGTAACGTCAATG / 10F / 16S / Diagnostic - Serratia-specific / Ferrari et al 2012
X420R / GCAACACTCTTTGCATTGCT / 10F / 16S / Diagnostic - X-type / Ferrari et al 2012
16SA1 / AGAGTTTGATCMTGGCTCAG / Diagnostic / 16S / Universal eubacterial primer / Fukatsu & Nikoh 1998
Ric16SR2 / TCCACGTCACCGTCTTGC / 16SA1 / 16S / Diagnostic - Rickettsia / Sakurai et al 2005
Ric16SR1 / TTTGAAAGCAATTCCGAGGT / 16SA1 / 16S / Alternative diagnostic - Rickettsia / McLean et al 2011
Spi16SR / ATCATCAACCCTGCCTTTGG / 16SA1 / 16S / Diagnostic - Spiroplasma / McLean et al 2011
RCL16S-211F / GGGCCTTGCGCTCTAGGT / RCL16S-470R / 16S / Diagnostic - Rickettsiella / Tsuchida et al 2010
RCL16S-470R / TGGGTACCGTCACAGTAATCGA / RCL16S-211F / 16S / Diagnostic - Rickettsiella / Tsuchida et al 2010
S23F / GGTCCGAGAGCATTCATTAGG / S23R / Microsatellite - S. avenae / Wilson et al. 2004
S23R / CGTCGTTGTCATTGTCGTCG / S23F / Microsatellite - S. avenae / Wilson et al. 2004
S24F / CCCGACCCCGTCCATTCAAA / S24R / Microsatellite - S. avenae / Wilson et al. 2004
S24R / CCTCCACCACTACTTTCACTCC / S24F / Microsatellite - S. avenae / Wilson et al. 2004
S30F / CCGACATAAAACACACCCAG / S30R / Microsatellite - S. avenae / Wilson et al. 2004
S30R / GTTTTGCCTCCTCCCCTC / S30F / Microsatellite - S. avenae / Wilson et al. 2004
S16BF / ATAAAACAAAGAGCAATTCC / Aph_08MR / Microsatellite - S. avenae / Wilson et al. 2004
S16BR / GTAAAAGTAAAGGTTCCACG / Aph_08MF / Microsatellite - S. avenae / Wilson et al. 2004
S49F / CGCATTTAGGAGGTTTCGAC / S49R / Microsatellite - S. avenae / Wilson et al. 2004
S49R / CATGTGCAGTGGAGCAGGAA / S49F / Microsatellite - S. avenae / Wilson et al. 2004
Sm10F / TCTGCTGCATTACTGTTGGC / Sm10R / Microsatellite - S. avenae / Simon et al 1999
Sm10R / TCGTCTACTTCGCCGTCA / Sm10F / Microsatellite - S. avenae / Simon et al 1999
LepF / ATTCAACCAATCATAAAGATATTGG / LepR / COI / Barcoding (aphids, parasitoids) / Foottit et al 2008
LepR / TAAACTTCTGGATGTCCAAAAAATCA / LepF / COI / Barcoding (aphids, parasitoids) / Foottit et al 2008
Table S1.Sequences of primers used for PCR reactions during this study
Clone / Counts / Symbiont / Microsatellite profileTriticum / Dactylis / Avena / S16B / S19 / S23 / S24 / S30 / S49 / Sm10
Co05 / 1 / Ha-4 / 171 / 207 / 235 / 235 / 132 / 132 / 177 / 185 / 161 / 163 / 117 / 131 / 164 / 168
Co07 / 1 / Ha-3 + Re-2 / 171 / 228 / 122 / 235 / 132 / 147 / 181 / 181 / 163 / 171 / 117 / 131 / 164 / 164
Co08 / 1 / Ha-2 / 157 / 171 / 229 / 231 / 132 / 147 / 165 / 181 / 161 / 173 / 91 / 115 / 164 / 164
Co09 / 1 / Ha-3 / 228 / 251 / 182 / 235 / 132 / 132 / 165 / 177 / 161 / 161 / 117 / 131 / 164 / 164
Co12 / 1 / Ha-1 / 171 / 205 / 122 / 199 / 132 / 140 / 165 / 165 / 163 / 171 / 91 / 129 / 160 / 164
Co16 / 1 / none / 205 / 268 / 223 / 235 / 132 / 132 / 177 / 185 / 163 / 163 / 117 / 119 / 164 / 164
Co19 / 1 / Ha-4 / 175 / 205 / 122 / 235 / 132 / 132 / 167 / 185 / 161 / 163 / 117 / 117 / 164 / 168
Co21 / 7 1 / 1*1 / 1*2+1*3 / 1 Re-2
2 Re-2 + Ss
3 Re-2 + Ha-3 + Sp / 171 / 205 / 122 / 223 / 132 / 140 / 165 / 175 / 171 / 171 / 117 / 125 / 152 / 166
Co23 / 2 / Ha-3 / 171 / 258 / 135 / 235 / 132 / 132 / 165 / 185 / 163 / 163 / 117 / 117 / 164 / 164
Co26 / 1 / Ha-4 / 258 / 268 / 207 / 223 / 132 / 132 / 183 / 185 / 163 / 163 / 117 / 119 / 164 / 164
Co28 / 1 / none / 171 / 175 / 223 / 261 / 132 / 142 / 177 / 181 / 163 / 171 / 117 / 131 / 168 / 168
Co29 / 1 / none / 220 / 237 / 182 / 182 / 140 / 147 / 165 / 181 / 161 / 163 / 119 / 125 / 164 / 164
Co31 / 1 / none / 211 / 239 / 150 / 235 / 132 / 147 / 165 / 181 / 163 / 163 / 117 / 125 / 166 / 166
Co32 / 3 4 +1 5 / 1 *4 / 4 none
5 Re-1 / 171 / 258 / 148 / 235 / 132 / 132 / 181 / 185 / 161 / 163 / 111 / 119 / 160 / 164
Co34 / 3 / Re-1 / 157 / 171 / 122 / 135 / 132 / 147 / 165 / 165 / 161 / 163 / 91 / 91 / 164 / 166
Co37 / 1 / 1 * / Ha-3 / 258 / 268 / 153 / 199 / 132 / 132 / 181 / 183 / 163 / 171 / 117 / 127 / 164 / 164
Co39 / 1 6 / 1 *7 / 6 none
7 Re-3 + Ha-4 + Ss / 171 / 171 / 156 / 199 / 132 / 132 / 175 / 183 / 163 / 171 / 111 / 135 / 164 / 166
Co41 / 1 / Ha-4 / 171 / 205 / 223 / 235 / 132 / 140 / 181 / 183 / 163 / 163 / 117 / 117 / 164 / 164
Co45 / 1 / Ha-4 / 171 / 205 / 223 / 235 / 132 / 147 / 181 / 185 / 163 / 163 / 117 / 135 / 164 / 164
Co47 / 1 / Ha-4 / 171 / 205 / 235 / 235 / 132 / 132 / 177 / 185 / 161 / 163 / 119 / 127 / 164 / 164
Co49 / 4 8 / 2 8 +1 9 / 8 Ha-4
9 Re-3 / 258 / 268 / 223 / 235 / 132 / 132 / 183 / 185 / 163 / 163 / 117 / 119 / 164 / 164
Co50 / 4 10 / 1 *11 / 10 none
11 Ha-1 / 171 / 228 / 223 / 235 / 132 / 132 / 165 / 165 / 165 / 171 / 117 / 119 / 166 / 166
Table S2.Characteristics of the grain aphid microsatellite genotypes collected in June 2008 at two sites in Oxfordshire, UK. For each genotype, we list the numbers of aphids collected from each of three host plants, its symbiont complement, and its profile at seven microsatellite loci. The abbreviations of the symbiont names are Ha (Hamiltonella defensa), Re (Regiella insecticola), Ss (Serratia symbiotica) and Sp (Serratia proteamaculans), followed by a number identifying a distinct 16S genotype.Asterisk (*) indicates aphids collected in Lower Radley; all other aphids were collected near Great Coxwell.1-11 For microsatellite genotypes collected more than once and found to be naturally polymorphic for symbiont infections, counts are given separately for each infection status, indicated by a number in superscript. These infection statuses are explained in the column “Symbiont” in the same rows.
Wingless morph – strains Ha-Co08, Ha-Co23 and Ha-Co26Factor(s) / d.f. / D.E. / % D.E. / F / p
Block / 2 / 126.0 / 1.83 / 1.81 / 0.17
Original infection status / 1 / 749.1 / 10.91 / 21.56 / < 0.001
Block × Original infection status (~ Aphid genotype) / 2 / 108.4 / 1.58 / 1.56 / 0.21
Present infection status / 1 / 70.9 / 1.03 / 2.04 / 0.16
Block × Present infection status (~ Symbiont strain) / 2 / 503.2 / 7.33 / 7.24 / 0.001
Original infection status × Present infection status / 1 / 27.1 / 0.39 / 0.78 / 0.37
Block × Original infection status × Present infection status / 2 / 765.8 / 11.15 / 11.02 / < 0.001
Residual / 141 / 4516.0
Winged morph – strain Ha-Co37
Factor(s) / d.f. / D.E. / % D.E. / F / p
Original infection status / 1 / 59.6 / 4.32 / 2.29 / 0.14
Present infection status / 1 / 61.0 / 4.62 / 2.35 / 0.13
Original infection status × Present infection status / 1 / 12.8 / 1.01 / 0.49 / 0.49
Residual / 48 / 1246.5
Table S3.Analysis of the effects of Hamiltonella infection on grain aphid fecundity (Experiment 1), separate for three blocks in which wingless aphids were scored and a single block in which winged aphids were scored. As in Table 2, terms were added sequentially to a generalised linear model assuming Gaussian errors. For each term the table shows the degrees of freedom (d.f.) involved, the deviance explained (D.E.) and deviance expressed as a percentage of the total deviance (%D.E.), and the associated F statistic and probability. The fecundity effects of each symbiont strain were simultaneously measured in two aphid genotypes (one originally infected and one not) in a separate temporal block. Hence, the main effects of aphid genotype and symbiont strains are confounded with block, and approximated by Block × Original Infection Status and Block × Present Infection Status, respectively. Results of the analysis for the four blocks together are shown in Table 2.
Figure S1.Susceptibility (mean ± S.E.) to the parasitoid Aphidius ervi of Hamiltonella-infected and symbiont-free lines of eight grain aphid genotypes. Each of the four symbiont strains, represented by ovals of the same shape and colour, was tested in its original host genotype (white bars) and in a novel, naturally symbiont-free genotype (grey bars).
Figure S2.Dry weights (mean ± S.E.) of two species of parasitoid species emerging from lines either naturally free of infection with secondary symbionts (white bars) or artificially infected with different strains of Hamiltonella defensa (grey bars) of four grain aphid genotypes. Data are shown separately for females (uniform bars) and males (diagonally striped bars). Asterisks indicate significant differences according to Tukey’s HSD test between the two lines of the same sex and aphid genotype.
References
Ferrari J, West JA, Via S, Godfray HCJ (2012) Population genetic structure and secondary symbionts in host-associated populations of the pea aphid complex. Evolution 66:375-390
Foottit RG, Maw HEL, Von Dohlen CD, Hebert PDN (2008) Species identification of aphids (Insecta: Hemiptera: Aphididae) through DNA barcodes. Molecular Ecology Resources 8:1189-1201
Fukatsu T, Nikoh N (1998) Two intracellular symbiotic bacteria from the mulberry psyllid Anomoneura mori (Insecta, Homoptera). Applied and Environmental Microbiology 64:3599-3606
McLean AHC, van Asch M, Ferrari J, Godfray HCJ (2011) Effects of bacterial secondary symbionts on host plant use in pea aphids. Proceedings of the Royal Society B: Biological Sciences 278:760-766
Russell JA, Moran NA (2005) Horizontal transfer of bacterial symbionts: Heritability and fitness effects in a novel aphid host. Applied and Environmental Microbiology 71:7987-7994
Sakurai M, Koga R, Tsuchida T, Meng XY, Fukatsu T (2005) Rickettsia symbiont in the pea aphid Acyrthosiphon pisum: Novel cellular tropism, effect on host fitness, and interaction with the essential symbiont Buchnera. Applied and Environmental Microbiology 71:4069-4075
Sandstrom JP, Russell JA, White JP, Moran NA (2001) Independent origins and horizontal transfer of bacterial symbionts of aphids. Molecular Ecology 10:217-228
Simon JC et al. (1999) Reproductive mode and population genetic structure of the cereal aphid Sitobion avenae studied using phenotypic and microsatellite markers. Molecular Ecology 8:531-545
Tsuchida T et al. (2010) Symbiotic bacterium modifies aphid body color. Science 330:1102-1104
Wilson ACC et al. (2004) Cross-species amplification of microsatellite loci in aphids: assessment and application. Molecular Ecology Notes 4:104-109