Table S1 Soil chemical characteristics between soil samples of traditional farmland and American ginseng farmland
Soils / pH / Total N(g kg-1) / Olsen-P
(g kg-1) / Available K
(mg kg-1) / Organic matter
(g kg-1)
TF / 6.89±0.06 / 0.94±0.05 / 25.3±1.42 / 119±11.3 / 16.4±0.94
AGF / 6.64±0.02 / 0.96±0.02 / 10.47±1.05* / 126±6.05 / 16.7±0.43
TF: Traditional farmland; AGF: American ginseng farmland. Each data was presented the mean ± SD of n = 3, and the asterisk stand for significant in the treatments with the control at 0.05 level.
Table S2 List of the 10-bp barcodes used to tag each PCR of bacterial production analyzed
acgttaccgt / agtcgagagaactcacagag / agtctgactg
agcactgtag / agtgacacac
Table S3 Bacterial and fungal numbers of sequences, derived OTUs and average length in each sample
Samples / Bacterial community / Fungal communitySequences / OTUs / Average Length / Sequences / OTUs / Average Length
TF1 / 8096 / 5836 / 229 / 2972 / 813 / 280
TF2 / 9458 / 6481 / 222 / 3396 / 834 / 282
TF3 / 5812 / 4500 / 224 / 2922 / 801 / 281
AGF1 / 6749 / 4784 / 228 / 4296 / 1060 / 274
AGF2 / 8386 / 5904 / 223 / 5563 / 1266 / 260
AGF3 / 7293 / 4919 / 220 / 1454 / 49961 / 225
TF: Traditional farmland; AGF: American ginseng farmland.
Table S4 The relative abundance (<0.5%) of bacterial groups of each sample at the order lever.
Taxon / TF / AGFMicrococcales / 0.084±0.027 / 0.070±0.023
Euzebyales / 0.033±0.009 / 0.009±0.005*
Armatimonadales / 0.062±0.016 / 0.033±0.017
Chthonomonadales / 0.028±0.007 / 0.170±0.083*
Bacteroidales / 0.047±0.020 / 0.055±0.026
Flavobacteriales / 0.098±0.033 / 0.103±0.032
Chlamydiales / 0.018±0.011 / 0.005±0.005
Chlorobiales / 0.000±0.000 / 0.004±0.004
Anaerolineales / 0.009±0.005 / 0.013±0.007
Caldilineales / 0.258±0.077 / 0.148±0.050*
Chloroflexales / 0.069±0.030 / 0.014±0.009*
Roseiflexales / 0.449±0.031 / 0.536±0.146
Dehalococcoidales / 0.004±0.004 / 0.014±0.008
Ktedonobacterales / 0.025±0.019 / 0.018±0.005
Thermogemmatisporales / 0.297±0.074 / 0.991±0.593*
Thermobaculales / 0.065±0.024 / 0.112±0.034
Thermomicrobiales / 0.008±0.008 / 0.004±0.004
Chlorophyta / 0.065±0.036 / 0.009±0.009*
Stramenopiles / 0.062±0.011 / 0.059±0.026
Streptophyta / 0.353±0.051 / 0.698±0.460*
Nostocales / 0.061±0.021 / 0.004±0.004
Chroococcales / 0.105±0.011 / 0.004±0.004*
Oscillatoriales / 0.135±0.042 / 0.005±0.005*
Pseudanabaenales / 0.272±0.021 / 0.014±0.014*
Elusimicrobiales / 0.096±0.036 / 0.209±0.043*
Fibrobacterales / 0.004±0.004 / 0.005±0.005
Haloplasmatales / 0.000±0.000 / 0.004±0.004
Lactobacillales / 0.015±0.008 / 0.096±0.096*
Turicibacterales / 0.000±0.000 / 0.005±0.005
Clostridiales / 0.208±0.023 / 0.237±0.009
Coriobacteriales / 0.008±0.004 / 0.008±0.008
Halanaerobiales / 0.006±0.006 / 0.005±0.005
Natranaerobiales / 0.004±0.004 / 0.009±0.005
Fusobacteriales / 0.000±0.000 / 0.004±0.004
Gemmatimonadales / 0.038±0.002 / 0.107±0.079*
Phycisphaerales / 0.175±0.017 / 0.233±0.090
Gemmatales / 0.698±0.081 / 1.082±0.226*
Pirellulales / 0.015±0.010 / 0.087±0.053
Planctomycetales / 0.000±0.000 / 0.037±0.037
Caulobacterales / 0.271±0.051 / 0.305±0.060
Rhodobacterales / 0.585±0.039 / 0.234±0.049*
Rickettsiales / 0.096±0.016 / 0.131±0.046
Gallionellales / 0.293±0.039 / 0.730±0.228*
Hydrogenophilales / 0.011±0.011 / 0.009±0.004
Methylophilales / 0.064±0.020 / 0.121±0.032*
Neisseriales / 0.004±0.004 / 0.005±0.005
Nitrosomonadales / 0.168±0.040 / 0.136±0.024
Procabacteriales / 0.000±0.000 / 0.009±0.004
Rhodocyclales / 0.045±0.012 / 0.051±0.014
Bdellovibrionales / 0.171±0.029 / 0.077±0.028*
Desulfobacterales / 0.009±0.005 / 0.005±0.005
Desulfovibrionales / 0.004±0.004 / 0.005±0.005
Desulfuromonadales / 0.037±0.013 / 0.008±0.008*
Spirobacillales / 0.150±0.043 / 0.109±0.048
Acidithiobacillales / 0.008±0.008 / 0.010±0.005
Alteromonadales / 0.048±0.020 / 0.037±0.019
Chromatiales / 0.069±0.003 / 0.062±0.017
Enterobacteriales / 0.044±0.015 / 0.054±0.035
Legionellales / 0.338±0.052 / 0.584±0.051*
Methylococcales / 0.011±0.011 / 0.031±0.008
Oceanospirillales / 0.019±0.008 / 0.028±0.009
Thiotrichales / 0.007±0.007 / 0.005±0.005
Vibrionales / 0.004±0.004 / 0.009±0.005
Spirochaetales / 0.000±0.000 / 0.013±0.008
Synergistales / 0.016±0.011 / 0.008±0.008
Anaeroplasmatales / 0.480±0.110 / 0.414±0.068
Opitutales / 0.075±0.007 / 0.063±0.030
Verrucomicrobiales / 0.069±0.022 / 0.030±0.010
TF and AGF refer to soil samples from traditional farmland and American ginseng farmland, respectively. An asterisk denotes a significant difference between TF and AGF at P < 0.05. The value of each bar represents the mean ± SD of n=3.
Table S5 The relative abundance (<0.4%) of bacterial groups of each sample at the family level
Taxon / TF / AGFIamiaceae / 0.051±0.008 / 0.004±0.004*
Microthrixaceae / 0.008±0.004 / 0.005±0.005
Actinosynnemataceae / 0.106±0.018 / 0.030±0.010*
Cellulomonadaceae / 0.092±0.009 / 0.045±0.009
Corynebacteriaceae / 0.004±0.004 / 0.022±0.004*
Frankiaceae / 0.022±0.012 / 0.043±0.022
Geodermatophilaceae / 0.179±0.016 / 0.053±0.006*
Intrasporangiaceae / 0.256±0.046 / 0.173±0.053
Microbacteriaceae / 0.592±0.074 / 0.251±0.043*
Micrococcaceae / 1.887±0.257 / 0.635±0.058*
Micromonosporaceae / 0.277±0.055 / 0.271±0.081
Mycobacteriaceae / 0.107±0.023 / 0.157±0.014
Nocardiaceae / 0.083±0.012 / 0.052±0.010
Nocardiopsaceae / 0.015±0.009 / 0.005±0.005
Promicromonosporaceae / 0.044±0.004 / 0.023±0.009
Propionibacteriaceae / 0.368±0.074 / 0.170±0.061*
Pseudonocardiaceae / 0.168±0.047 / 0.126±0.040
Sporichthyaceae / 0.089±0.009 / 0.099±0.008
Streptomycetaceae / 0.488±0.049 / 0.317±0.049
Streptosporangiaceae / 0.110±0.004 / 0.079±0.011
Thermomonosporaceae / 0.077±0.011 / 0.021±0.011
Euzebyaceae / 0.033±0.009 / 0.009±0.005
Rubrobacteraceae / 0.811±0.108 / 0.230±0.118*
Conexibacteraceae / 0.067±0.007 / 0.197±0.129
Patulibacteraceae / 0.106±0.005 / 0.027±0.002*
Solirubrobacteraceae / 0.457±0.141 / 0.147±0.018
Armatimonadaceae / 0.053±0.019 / 0.010±0.005
Chthonomonadaceae / 0.028±0.007 / 0.170±0.083*
Cryomorphaceae / 0.012±0.012 / 0.005±0.005
Flavobacteriaceae / 0.085±0.031 / 0.098±0.037
Amoebophilaceae / 0.006±0.006 / 0.023±0.006
Balneolaceae / 0.025±0.006 / 0.025±0.018
Ekhidnaceae / 0.004±0.004 / 0.000±0.000
Saprospiraceae / 0.173±0.026 / 0.226±0.108
Sphingobacteriaceae / 0.759±0.068 / 0.878±0.165
Waddliaceae / 0.004±0.004 / 0.000±0.000
Caldilineaceae / 0.258±0.077 / 0.148±0.050*
Chloroflexaceae / 0.020±0.010 / 0.005±0.005
Oscillochloridaceae / 0.018±0.011 / 0.000±0.000
Kouleothrixaceae / 0.275±0.055 / 0.393±0.100
Roseiflexaceae / 0.124±0.038 / 0.130±0.043
Thermogemmatisporaceae / 0.281±0.082 / 0.909±0.551
Thermobaculaceae / 0.065±0.024 / 0.112±0.034
Cyanobacteriaceae / 0.023±0.006 / 0.004±0.004
Phormidiaceae / 0.135±0.042 / 0.005±0.005*
Pseudanabaenaceae / 0.272±0.021 / 0.014±0.014
Fibrobacteraceae / 0.004±0.004 / 0.005±0.005
Alicyclobacillaceae / 0.096±0.049 / 0.023±0.013
Paenibacillaceae / 0.442±0.081 / 0.250±0.065
Planococcaceae / 0.277±0.046 / 0.091±0.021*
Staphylococcaceae / 0.004±0.004 / 0.019±0.012
Thermoactinomycetaceae / 0.066±0.023 / 0.035±0.010
Streptococcaceae / 0.004±0.004 / 0.009±0.012
Clostridiaceae / 0.101±0.008 / 0.107±0.020
Lachnospiraceae / 0.038±0.015 / 0.022±0.017
Peptococcaceae / 0.016±0.016 / 0.013±0.005
Peptostreptococcaceae / 0.013±0.002 / 0.022±0.005*
Ruminococcaceae / 0.004±0.004 / 0.013±0.005
Sulfobacillaceae / 0.009±0.005 / 0.013±0.007
Symbiobacteriaceae / 0.012±0.007 / 0.005±0.005
Syntrophomonadaceae / 0.006±0.006 / 0.005±0.005
Veillonellaceae / 0.004±0.004 / 0.010±0.005
Halanaerobiaceae / 0.006±0.006 / 0.005±0.005
Phycisphaeraceae / 0.004±0.004 / 0.013±0.007
Gemmataceae / 0.597±0.055 / 0.849±0.192
Isosphaeraceae / 0.101±0.029 / 0.233±0.035*
Pirellulaceae / 0.015±0.010 / 0.083±0.055
Caulobacteraceae / 0.259±0.058 / 0.287±0.055
Beijerinckiaceae / 0.113±0.020 / 0.097±0.005
Brucellaceae / 0.019±0.011 / 0.026±0.007
Methylobacteriaceae / 0.011±0.011 / 0.026±0.016
Methylocystaceae / 0.130±0.027 / 0.147±0.023
Phyllobacteriaceae / 0.075±0.032 / 0.112±0.034
Rhizobiaceae / 0.091±0.026 / 0.095±0.033
Rhodobiaceae / 0.184±0.038 / 0.221±0.075
Xanthobacteraceae / 0.110±0.033 / 0.032±0.025
Hyphomonadaceae / 0.100±0.035 / 0.155±0.030
Rhodobacteraceae / 0.485±0.052 / 0.079±0.020*
Acetobacteraceae / 0.199±0.032 / 0.333±0.093*
Pelagibacteraceae / 0.008±0.004 / 0.005±0.005
Rickettsiaceae / 0.010±0.005 / 0.005±0.005
Erythrobacteraceae / 0.087±0.014 / 0.027±0.009*
Alcaligenaceae / 0.374±0.058 / 0.400±0.043*
Burkholderiaceae / 0.165±0.034 / 0.353±0.194*
Oxalobacteraceae / 0.562±0.114 / 0.351±0.026*
Methylophilaceae / 0.064±0.016 / 0.121±0.024*
Nitrosomonadaceae / 0.168±0.040 / 0.136±0.024
Procabacteriaceae / 0.000±0.000 / 0.009±0.004
Rhodocyclaceae / 0.045±0.012 / 0.051±0.014
Bacteriovoracaceae / 0.040±0.008 / 0.014±0.009
Bdellovibrionaceae / 0.127±0.034 / 0.054±0.033
Nitrospinaceae / 0.009±0.005 / 0.005±0.005
Desulfovibrionaceae / 0.004±0.004 / 0.005±0.005
Cystobacteraceae / 0.119±0.033 / 0.051±0.027*
Cystobacterineae / 0.012±0.007 / 0.010±0.005
Haliangiaceae / 0.370±0.039 / 0.325±0.039
Myxococcaceae / 0.064±0.016 / 0.053±0.024
Nannocystaceae / 0.023±0.012 / 0.066±0.046
Polyangiaceae / 0.209±0.053 / 0.120±0.031*
Desulfobacteraceae / 0.012±0.007 / 0.016±0.016
Syntrophaceae / 0.060±0.020 / 0.062±0.011
Syntrophorhabdaceae / 0.004±0.004 / 0.000±0.000
Helicobacteraceae / 0.000±0.000 / 0.004±0.004
Alteromonadaceae / 0.028±0.012 / 0.018±0.009
Chromatiaceae / 0.010±0.005 / 0.004±0.004
Ectothiorhodospiraceae / 0.023±0.006 / 0.028±0.016
Enterobacteriaceae / 0.044±0.015 / 0.054±0.035
Coxiellaceae / 0.259±0.049 / 0.399±0.068*
Legionellaceae / 0.020±0.006 / 0.065±0.011
Methylococcaceae / 0.011±0.011 / 0.026±0.006
Moraxellaceae / 1.683±0.404 / 4.124±1.198*
Pseudomonadaceae / 0.235±0.033 / 0.520±0.109*
Vibrionaceae / 0.004±0.004 / 0.009±0.005
Spirochaetaceae / 0.000±0.000 / 0.013±0.008
Leptospiraceae / 0.000±0.000 / 0.010±0.005
Anaeroplasmataceae / 0.480±0.110 / 0.414±0.068
Deinococcaceae / 0.013±0.007 / 0.000±0.000
Verrucomicrobiaceae / 0.069±0.022 / 0.030±0.010
TF and AGF refer to soil samples from traditional farmland and American ginseng farmland, respectively. An asterisk denotes a significant difference between TF and AGF at P < 0.05. The value of each bar represents the mean ± SD of n=3.
Table S6 The relative abundance (<0.2%) of fungal groups of each sample
Taxon / TF / AGFBlastocladiaceae / 0.165±0.026 / 0.094±0.047
Physodermataceae / 0.063±0.047 / 0.023±0.023
Chytridiaceae / 0.018±0.009 / 0.026±0.016
Megachytriaceae / 0.000±0.000 / 0.020±0.011*
Rhizophydiaceae / 0.022±0.011 / 0.023±0.023
Terramycetaceae / 0.000±0.000 / 0.012±0.012
Spizellomycetaceae / 0.352±0.062 / 0.148±0.008*
Monoblepharidaceae / 0.000±0.000 / 0.006±0.006
Laboulbeniomycetes / 0.101±0.009 / 0.128±0.071
Lichinomycetes / 0.063±0.002 / 0.058±0.011
Orbiliomycetes / 0.082±0.018 / 0.049±0.013
Neolectales / 0.014±0.010 / 0.000±0.000
Pneumocystidomycetes / 0.000±0.000 / 0.006±0.006
Schizosaccharomycetes / 0.047±0.029 / 0.026±0.016
Taphrinomycetes / 0.011±0.011 / 0.000±0.000
Anguillospora / 0.082±0.018 / 0.051±0.031
Lecophagus / 0.010±0.010 / 0.066±0.017*
Neoplaconema / 0.036±0.032 / 0.012±0.012
Phaeomoniella / 0.018±0.009 / 0.012±0.012
Phoma / 0.059±0.016 / 0.052±0.017
Pulchromyces / 0.084±0.012 / 0.000±0.000*
Sirococcus / 0.062±0.021 / 0.070±0.001
Dacrymycetes / 0.000±0.000 / 0.006±0.006
Wallemiomycetes / 0.000±0.000 / 0.041±0.021*
Agaricostilbomycetes / 0.025±0.021 / 0.014±0.007
Cystobasidiomycetes / 0.074±0.024 / 0.028±0.014*
Microbotryomycetes / 0.003±0.003 / 0.138±0.035*
Pucciniomycetes / 0.029±0.003 / 0.008±0.008
Exobasidiomycetes / 0.041±0.009 / 0.072±0.011
Ustilaginomycetes / 0.075±0.029 / 0.018±0.018*
Entomophthorales / 0.019±0.010 / 0.029±0.021
Harpellales / 0.000±0.000 / 0.012±0.012
Kickxellales / 0.072±0.033 / 0.194±0.064*
Endogonales / 0.012±0.009 / 0.049±0.027
Mortierellales / 0.039±0.008 / 0.083±0.042
Zoopagales / 0.177±0.021 / 0.169±0.020
Ambisporaceae / 0.057±0.039 / 0.020±0.011
Acaulosporaceae / 0.215±0.129 / 0.101±0.031*
Pacisporaceae / 0.000±0.000 / 0.014±0.007
Scutellosporaceae / 0.000±0.000 / 0.008±0.008
Paraglomeraceae / 0.060±0.038 / 0.012±0.012
TF and AGF refer to soil samples from traditional farmland and American ginseng farmland, respectively. An asterisk denotes a significant difference between TF and AGF at P < 0.05. The value of each bar represents the mean ± SD of n=3.