Table S1: Normalized Liver Mass Spec Data and Results of Signature Analysis

1

Dayton et al,

Table S1: Normalized liver mass spec data and results of signature analysis.

Complete list of metabolites identified through differential signature analysis of all known-metabolites detected in M2+/+ (WT) and M2-/- (KO) livers by LC-MS analysis. Columns represent metabolite identifiers, signature correlation z-scores (see methods), normalized values per sample, Student’s t-test p-value and FDR, KO/WT fold change (FC) and log2 FC, and average values in KO and WT conditions. The final three columns include tags for high-confidence and secondary metabolites identified as differentially represented between WT and KO, followed by the direction of their fold change.

Table S2: Normalized liver mass spec data for all known-metabolites

Normalized ion counts for all known metabolites identified in M2+/+ and M2-/- livers by LC-MS analysis. Columns represent LC-MS method, compound, mass to charge ratio (m/z), retention time (RT), metabolite identifiers, normalized values per sample, and average values in KO and WT conditions.

Table S3: Liver RNA-seq expression counts and differential analysis results.

RNA-seq analysis of all differentially expressed genes in M2+/+ and M2-/- livers from 35-week old mice. Columns represent gene name, raw expression counts per sample, normalized expression counts, and differential expression results (False-discovery rate [FDR], fold-change [FC], log2 FC, and direction of FC). NA values indicate that the corresponding gene was not included in differential expression analysis due to low expression values across all samples.

Table S4: GSEA report RNA-Seq differential expression analysis of all expressed genes in WT and Pkm2-/- livers

Complete list of enriched gene sets identified through GSEA based on RNA-Seq differential expression analysis of all expressed genes in M2+/+ and M2-/- livers 35-week old mice. The MSigDB curated gene set collection (Subramanian et al., 2005) was used for this analysis. Columns represent GSEA gene set name, normalized enrichment score (NES), FDR and p-value statistics, and rank and max.

Supplemental Figure S1. Related to Figure 1

(A) Schematic showing the mouse Pkm locus; the wildtype (Pkm2+), Pkm2 floxed (Pkm2fl), and Pkm2 null (Pkm2-) alleles are depicted.

(B) PCR genotyping of genomic DNA from Pkm2-/-, Pkm2+/-, Pkm2+/+, and Pkm2fl/fl mice. Amplicon sizes for floxed, wildtype, and null alleles are: 577 bp, 509bp, and 197bp, respectively

(C) Representative images showing expression patterns of PK-M1 and PK-M2 protein in mouse adrenal glands and testes. Corresponding H&E images are shown. Scale bars, 20mm.

(D) Expression patterns of PK-M1 (left panels) and PK-M2 (right panels) protein as assessed by PK-M1 and PK-M2 IHC on WT mouse brain. Arrows indicate the choroid plexus. Scale bars are 100 mm (left) and 20 mm (right), respectively.

Supplemental Figure S2. Related to Figure 2

(A) Representative images of IHC for PK-M1 and PK-M2 in normal adult human tissue sections from a tissue microarray (TMA). Corresponding H&E images are shown in the right panels. All images are 20X. Scale bars are 50 mm.

(B) Autoradiograph of uncut Pkm cDNA amplicons (from exon 8 to exon 11) of cDNA isolated from the indicated M2+/+ and M2-/- tissues. PK-M1 and PK-M2 amplicons are the same size. The lower band corresponds to previously described PKMskip product.

(C) Pyruvate kinase enzymatic activity assays in kidney, lung, colon, skeletal muscle (gastrocnemius), or liver tissue lysates isolated from M2+/+, M2+/-, or M2-/- mice. Values shown are for baseline enzymatic activity from tissue lysates when no FBP was added to the reaction mixtures. P-value using unpaired t-test is shown, *p<0.05, n=3 mice.

Supplemental Figure S3. Related to Figure 3

(A) Table summarizing tumor incidence in M2-/- female mice.

(B) Expression of Pklr mRNA in M2+/+ livers, M2-/- livers, and M2-/- HCC was determined by qRT-PCR.

(C) Representative images of IHC for PK-M2 and dual-color IHC for PK-M2 (brown/left) or PK-M1 (brown/right) and total Hnf4a (purple) in M2+/+ liver. All images are 40X. Scale bars are 20 mm. A cluster of lymphocytes in the bottom panels is indicated by “Ly” and an arrow.

(D) Western blot analysis for PK-M1 and PK-M2 protein on liver tissue lysates from WT and M2-/- mice.  was used as a loading control and WT skeletal muscle and kidney lysates were included as positive controls for PK-M1 and PK-M2, respectively.

(E) Representative image of dual-color IHC for PK-M1 (brown) and total Hnf4a (purple) in M2-/- liver. Scale bar is 20 mm. A cluster of lymphocytes is indicated by “Ly.”

(F) Representative image of dual-color IHC for PK-M2 (brown) and total Hnf4a (purple) in liver adenomas from M2+/+ mice. Scale bar is 20 mm.

(G) Representative images of IHC for PK-M1 (middle panels) and PK-M2 (right panels) human HCC from a tissue microarray (TMA). H&E images are shown in left panels. All images are 40X. Scale bars are 20 mm. Black arrows indicate stromal cells and asterisks mark tumor cells with PK-M2 expression.

(H) Expression of Pkm2 mRNA in human HCC and matched normal liver samples from The Cancer Genome Atlas (TCGA, cancergenome.nih.gov) was assessed. Empirical Cumulative Density Function (CDF) based on standardized expression values (z-score) and p-value (Kolmogorov-Smirnov test) are presented.

(I) Expression of Hmox and Gclc mRNA in M2+/+ livers, M2-/- livers, and M2-/- HCC was determined by qRT-PCR (n=4-10). Values are relative to b-actin. Mean values +/- SEM and p-values using unpaired t-test are shown, **p<0.01; ***p<0.001.

(J) Western blot analysis for g-H2AX protein on liver tissue lysates from WT mice, and liver and HCC tumor lysates from M2-/- mice.  was used as a loading control.

Supplemental Figure S4. Related to Figure 4

(A) Dendrogram showing sample relationships via clustering based on liver metabolite profiles.

(B) Unsupervised clustering based on principal component analysis (PCA) shows sample relationships based on liver metabolite profiles.

(C) Dendogram showing sample relationships via unsupervised clustering based on all expressed genes identified through RNA-seq analysis of livers.

(D) Enrichment plots for gene sets identified through GSEA based on RNA-Seq differential expression analysis of all expressed genes in M2+/+ and M2-/- livers. The MSigDB curated gene set collection (Subramanian et al., 2005) was used for this analysis. Complete list of enriched gene sets is included in Table S4.

(E) qRT-PCR validation of expression changes of key metabolic and immune response genes identified through RNA-Seq analysis of M2+/+ and M2-/- livers.

Supplemental Figure S5. Related to Figure 5

(A) Daily food intake by Pkm genotype and diet. Mean values +/- SEM are presented.

(B) 8 to 12-week old M2+/+ and M2-/- male mice were fed a LFD for 10-weeks. Weights were measured weekly. Mean values +/- SEM for each week are presented.

(C) Ratio of liver weight to body weight of mice fed a LFD as in (A) was calculated at the end of the 10-week regimen. Data are presented as the mean values +/- SEM.

(D) Representative H&E images of livers of mice fed a LFD as in (A). Scale bars are 100 mm (left) and 20 mm (right).

(E) Representative images of IHC for BrdU on livers from M2+/+ and M2-/- mice fed a HFD for 10 weeks. Scale bars are 100 mm (left) and 20 mm (right).

Supplemental Figure S6. Related to Figure 6

(A) Intraperitoneal glucose tolerance test (1.5 mg/kg) in age- and sex-matched M2+/+ and M2-/- mice. p-value was not significant.

(B and C) Fasting glucose (C) and insulin (D) levels were measured in age-matched female M2+/+ and M2-/- mice after a 16-hour fast. Mean and p-values using unpaired t-test are indicated, **p<0.01.

(D) Weights of young (6 to 10 weeks) or old (60 to 88 weeks) M2+/+ and Pkm2-deficient male mice. Data are presented as means +/- SEM; p-values using unpaired t-test are indicated, **p<0.01.

(E) Expression of Tnfa, CD45, and F4/80 mRNA in white adipose tissue from WT and M2-/- mice was determined by qRT-PCR (n=4-10). Values are relative to b-actin. Mean values +/- SEM and p-values using unpaired t-test are shown, *p<0.05.

Supplementary Materials and Methods

High Fat Diet Experiments (198)

Starting at 8 to 12 weeks of age, mice were fed either HFD (Research Diets Incorporated, D12492, 60 kcal% fat) or a LFD (Research Diets Incorporated, D12450B, 10 kcal% fat).

Quantification of Hepatic Steatosis (497)

Degree of steatosis was graded by histological analysis where none was defined as a morphologically normal liver with no evidence of lipid accumulation, mild was defined as a liver where 10 to 20% of the liver contained macro-vesicular lipid droplets, intermediate was defined as 50 to 60% of the liver contained both macro- and micro-vesicular lipid droplets, and severe was defined as >80% of the liver contained both macro- and micro-vesicular lipid droplets.

Global metabolomic analyses of tissue homogenates (589)

Metabolite profiles obtained using liquid chromatography-tandem mass spectrometry (LC-MS) at the Broad Institute of the Massachusetts Institute of Technology and Harvard University (Cambridge, MA). Liver tissue samples were homogenized in water (4 µL/mg of tissue) using a TissueLyser II (Qiagen) bead mill for 4 minutes at 20 Hz. Four separate liquid chromatography tandem mass spectrometry (LC-MS) methods (described in the supplementary methods) were used to measure polar metabolites and lipids in plasma and liver homogenates samples.

Metabolite Signature Data Analysis

Mass spec peak values for polar and non-polar metabolites were normalized to internal controls (internal controls used were dependent on the method and are described under the methods for global metabolomics analysis). Differential signature analysis between WT and KO samples was performed using a blind source separation methodology based on Independent Component Analysis (ICA) (Bhutkar et al., in submission). The R implementation of the core JADE algorithm (Joint Approximate Diagonalization of Eigenmatrices) (Rutledge and Bouveresse 2013; Biton et al. 2013) was used along with custom R utilities. The primary signal detected in the dataset differentiated between WT and KO samples. Metabolites with a signature correlation z-score exceeding 0.5 (alternatively, < -0.5) were selected and further filtered using a two-sided Student’s t-test significance threshold of p < 0.05 and a fold-change value exceeding 1.2X in either direction. Metabolites with an average normalized value less than1 in both conditions were dropped from further consideration due to low signal levels. This formed the set of high confidence differentially represented candidates (Table S1). A secondary set of candidates was selected based on the p-value, fold change, and signal thresholds described above. The primary and secondary candidates were used to generate a heatmap (see main text) to visualize differential activity between WT and KO samples. All analyses were conducted in R.

TCGA Human Tumor Data Analysis

Normalized PKM2 exon expression values (RPKM) for Liver Hepatocellular Carcinoma (LIHC) were obtained from The Cancer Genome Atlas (TCGA, https://tcga-data.nci.nih.gov/tcga/) and assessed for differential expression between normal tissue and primary tumors using a two-sided Kolmogorov-Smirnov test.

RNA Isolation and qRT-PCR

RNA was isolated from flash frozen ground whole tissue or tumors following manufacturer’s instructions for Trizol (Invitrogen). 1 to 2 mg of RNA was reverse transcribed following manufacturer’s instructions for High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). KAPA SYBR Fast mix (Kapa Biosystems, KK4604) was used for quantitative PCR with primers listed below. Expression levels were calculated relative to either Gapdh or b-actin and normalized to WT samples.

qRT PCR Primer Sequences

Target gene / Forward / Reverse
Gapdh / AGCTTGTCATCAACGGGAAG / TTTGATGTTAGTGGGGTCTCG
b-actin / GGCATAGAGGTCTTTACGGATGTC / TATTGGCAACGAGCGGTTCC
Pkm / TGACACCTTCCTGGAACACA / TTCAGCATCTCCACAGATCG
Pkm1 / GTCTGGAGAAACAGCCAAGG / TCTTCAAACAGCAGACGGTG
Pkm2 / GTCTGGAGAAACAGCCAAGG / CGGAGTTCCTCGAATAGCTG
Pklr / AAGGGTCCCGAGATACGCA / CTGCAACGACCTGGGTGATA
Srebf1 / GAGATGTGCGAACTGGACAC / CTCTCAGGAGAGTTGGCACC
Nqo1 / AGCGTTCGGTATTACGATCC / AGTACAATCAGGGCTCTTCTCG
Hmox1 / AGGCTAAGACCGCCTTCCT / TGTGTTCCTCTGTCAGCATCA
Gclc / AGATGATAGAACACGGGAGGAG / TGATCCTAAAGCGATTGTTCTTC
Il18 / TCTTGGCCCAGGAACAATGG / ACAGTGAAGTCGGCCAAAGT
Ucp2 / AAGTGTTTCGTCTCCCAGCC / CTAGCCCTTGACTCTCCCCT
Ide1 / GCTGTCACGGCTGCATATTG / CTGGATGATGAAGCGCAAGC
Erbb4 / ACTCCAATAGGAATCAGTTTGTGT / CTCCATTCTTCCTTCGGGACA
Nt5e / CTACCCAGGAACTCGGGAGA / GGATGCCACCTCCGTTTACA

Pkm splicing analysis for PKMskip

Pkm splicing analysis was performed through semiquantitative PCR as described previously (Clower et al. 2010). PCR products were not digested and were instead directly separated on a 5% native polyacrylamide gel. Primer sequences are as follows: 5′-ATGCTGGAGAGCATGATCAAGAAGCCACGC-3′ and 5′-CAACATCCATGGCCAAGTT-3′

LC-MS Methods for Global Metabolomic Analyses of Tissue Homogenates

Method 1. Positive ion mode MS analyses of polar metabolites were conducted using a Nexera X2 U-HPLC system (Shimadzu Scientific Instruments; Marlborough, MA) coupled to an Exactive Plus orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, MA). LC-MS samples were prepared from plasma (10 µL) via protein precipitation with the addition of nine volumes of 74.9:24.9:0.2 v/v/v acetonitrile/methanol/formic acid containing stable isotope-labeled internal standards (valine-d8, Isotec; and phenylalanine-d8, Cambridge Isotope Laboratories; Andover, MA). The samples are centrifuged (10 min, 9,000 x g, 4°C), and the supernatants were injected directly onto a 150 x 2 mm Atlantis HILIC column (Waters; Milford, MA). The column was eluted isocratically at a flow rate of 250 µL/min with 5% mobile phase A (10 mM ammonium formate and 0.1% formic acid in water) for 1 minute followed by a linear gradient to 40% mobile phase B (acetonitrile with 0.1% formic acid) over 10 minutes. MS analyses were carried out using electrospray ionization in the positive ion mode using full scan analysis over m/z 70-800 at 70,000 resolution and 3 Hz data acquisition rate. Additional MS settings were: ion spray voltage, 3.5 kV; capillary temperature, 350°C; probe heater temperature, 300 °C; sheath gas, 40; auxiliary gas, 15; and S-lens RF level 40.

Method 2. Negative ion mode, targeted MS analyses of polar metabolites we conducted using an ACQUITY UPLC (Waters) coupled to a 5500 QTRAP triple quadrupole mass spectrometer (AB SCIEX). Plasma samples (30µL) were extracted using 120 µL of 80% methanol (VWR) containing 0.05 ng/µL inosine-15N4, 0.05 ng/µL thymine-d4, and 0.1 ng/µL glycocholate-d4 as internal standards (Cambridge Isotope Laboratories). The samples were centrifuged (10 min, 9,000 x g, 4ºC) and the supernatants (10 µL) were injected directly onto a 150 x 2.0 mm Luna NH2 column (Phenomenex) that was eluted at a flow rate of 400 µL/min with initial conditions of 10% mobile phase A (20 mM ammonium acetate and 20 mM ammonium hydroxide (Sigma-Aldrich) in water (VWR)) and 90% mobile phase B (10 mM ammonium hydroxide in 75:25 v/v acetonitrile/methanol (VWR) followed by a 10 min linear gradient to 100% mobile phase A. The ion spray voltage was -4.5 kV and the source temperature was 500°C.

Method 3. Negative ion mode analysis of metabolites of intermediate polarity (e.g. bile acids and free fatty acids) were analyzed using a Nexera X2 U-HPLC system (Shimadzu Scientific Instruments; Marlborough, MA) coupled to a Q Exactive orbitrap mass spectrometer (Thermo Fisher Scientific; Waltham, MA). Plasma samples (30 µL) were extracted using 90 µL of methanol containing PGE2-d4 as an internal standard (Cayman Chemical Co.; Ann Arbor, MI) and centrifuged (10 min, 9,000 x g, 4°C). The supernatents (10 µL) were injected onto a 150 x 2 mm ACQUITY BEH C18 column (Waters; Milford, MA). The column was eluted isocratically at a flow rate of 400 µL/min with 25% mobile phase A (0.1% formic acid in water) for 1 minute followed by a linear gradient to 100% mobile phase B (acetonitrile with 0.1% formic acid) over 11 minutes. MS analyses were carried out using electrospray ionization in the negative ion mode using full scan analysis over m/z 200-550 at 70,000 resolution and 3 Hz data acquisition rate. Additional MS settings were: ion spray voltage, -3.5 kV; capillary temperature, 320°C; probe heater temperature, 300 °C; sheath gas, 45; auxiliary gas, 10; and S-lens RF level 60.