Supplementary Table S2 Genes Were Significantly Regulated More Than 2 Fold Score in Wheat

Supplementary Tables and Figures

Transcriptional profile of the spring freeze response in the leaves of bread wheat (Triticum aestivum L.)

ACTA PHISIOLOGIAE PLANTARUM

Guozhang Kang1*; Gezi Li1; Wenping Yang2; Qiaoxia Han1; Hongzhen Ma1; Yonghua Wang1; Jiangping Ren1; Yunji Zhu1; Tiancai Guo1*

1National Engineering Research Centre for Wheat, Key Laboratory of Physiology, Ecology and Genetic Improvement of Food Crops in Henan Province, Henan Agricultural University, 450002, Zhengzhou, China. e-mail: . Tel/fax: +86-371-63558202

2Department of Agriculture, Henan Institute of Science and Technology, 453003, Xinxiang, China. e-mail: . Tel: +86-0-15837397725

*Corresponding author: Tel/fax: +86-371-63558202

E-mail address: (G. Kang), (T. Guo)

Contents / Page
Fig. S1 / Effect of five days of −5℃ freeze stress on wheat plant (Yumai 34 cv) survival / 1
Fig. S2 / Expression profiles of selected freeze-regulated genes in the microarray experiments confirmed by quantitative real-time PCR / 1
Table S1 / List of the gene-specific primers used for quantitative real-time PCR / 1
Table S2 / Genes were significantly regulated more than 2 fold score in wheat leaves assayed at 1 and 3 days after −5°C freeze stress and compared to those in subzero acclimation in wheat and in freeze stress in barley / 15

Fig. S1 Effect of five days of −5℃ freeze stress on wheat plant (Yumai 34 cv) survival. The similar freeze injuries were also observed in other wheat cultivars and not indicated

Fig. S2 Expression profiles of selected freeze-regulated genes in the microarray experiments confirmed by quantitative real-time PCR

Notes: CA669389, Cold acclimation induced protein 2-1 (Ta.351.1.S1_at); L11882, Wali5 protein (Ta.21350.1.S1_x_at); AB055077, Multidrug resistance protein 1 homolog (Ta.2793.1.S1_at); U73214, Cold acclimation protein WCOR518 (Ta.23758.1.S1_x_at); BQ789086, Ethylene-responsive factor-like transcription factor ERFL1a (Ta.14000.1.S1_at); AY525640, Delta-type tonoplast intrinsic protein (Ta.1082.3.S1_at); CK197611, Phenylalanine ammonia-lyase (Ta.20429.1.S1_at); BJ219268, NADPH-thioredoxin reductase (Ta.812.2.A1_x_at)

Each value was the mean ± SD of three independent measurements

Table S1 List of the gene-specific primers used for quantitative real-time PCR

Probe set ID / Represent sequence ID / Primers / Predicated length (bp)
Ta.351.1.S1_at / CA669389 / 5' ATCGGCTACGCCATGCTA 3' / 131
5' TCACCAGCGGAAAACAAA 3'
Ta.21350.1.S1_x_at / L11882.1 / 5' CGGTGGACCCTGCAAGAA 3' / 107
5' CGCATAGGCACGATGACG 3'
Ta.2793.1.S1_at / AB055077.1 / 5' CACTGTTTTATTTGCCGT 3' / 120
5' TTCCTCTCAATCGTTTCA 3'
Ta.23758.1.S1_x_at / U73214.1 / 5' AGGTGCTCGTCAACCAATG 3' / 270
5' CCAACAGTTTCAGCGTATCG 3'
Ta.14000.1.S1_at / BQ789086 / 5' GACTCCTCGTCGGTCGTTG 3' / 235
5' AGGGCTCCTCGGTCTGTCTC 3'
Ta.1082.3.S1_at / AY525640.1 / 5' CCATCGCCTTCGGTCGCTT 3' / 137
5' GCCGCCGCTCACCTTAGTG 3'
Ta.20429.1.S1_at / CK197611 / 5' AAGGAGTGGAACGGTGAG 3' / 176
5' GCAATCTTTGGCAATACA 3'
Ta.2780.1.S1_at / BJ219268 / 5' CAAAGCAGCCATACAGCC 3' / 226
5' CGAGGTATCCGACTTCCAG 3'

Supplementary Table S2 Genes were significantly regulated more than 2 fold score in wheat leaves assayed at 1 and 3 days after −5°C freeze stress and compared to those in subzero acclimation in wheat and in freeze stress in barley

Probe set ID / Functional description / Represent sequence ID / Ratio (1 d) / Ratio (3 d) / Subzero acclimation1 / Freeze in barley2
Probe set ID / up/
down / Probe set ID / up/
down
Ta.12663.1.S1_at / Ice recrystallization inhibition protein 1 precursor / CK197682 / 101.772 / 755.606
Ta.245.1.S1_at / Cold-responsive protein COR14b / AF207546.1 / 86.985 / 293.09
Ta.13183.1.S1_x_at / Cold regulated protein / AB097412.1 / 66.412 / 259.781
Ta.24728.1.S1_at / Wcor719 protein / U58278.1 / 54.65 / 51.306
Ta.13183.1.S1_s_at / Cold regulated protein / AB097412.1 / 51.271 / 175.185
Ta.1165.1.A1_at / WCOR14a / AF207545.1 / 48.587 / 96.529
Ta.7091.1.S1_at / Pyrroline-5-carboxylate synthetase / CK194302 / 42.019 / 64.244
Ta.2788.1.A1_at / Sucrose:sucrose 1-fructosytransferase / CF133273 / 36.595 / 28.003
Ta.25843.1.A1_at / CBFIVc-B14 / CD453611 / 34.624 / 29.772
Ta.20434.1.S1_at / Xylanase inhibitor TAXI-IV / CD910722 / 31.193 / 50.602
Ta.27725.1.S1_at / Plasma membrane protein / AB030210.1 / 20.229 / 32.115
Ta.18203.1.S1_at / Blue copper-binding protein homolog / AF031195.1 / 18.742 / 45.434 / Contig17750_at / up
TaAffx.129134.1.S1_at / Glycosyltransferase / CK153845 / 18.168 / 4.644
Ta.3475.1.A1_at / Fructan:fructan 1-fructosyltransferase / CK206362 / 17.721 / 4.931
Ta.14000.1.S1_at / Ethylene-responsive factor-like transcription factor ERFL1a / BQ789086 / 16.266 / 9.459
Ta.145.1.A1_x_at / Wcs66 protein / L27516.1 / 14.608 / 171.92
Ta.351.2.S1_x_at / Cold acclimation induced protein 2-1 / CA673444 / 14.366 / 34.429
Ta.30336.1.S1_x_at / LEA D-11 dehydrin / AB076807.1 / 14.013 / 52.206
Ta.351.1.S1_at / Cold acclimation induced protein 2-1 / CA669389 / 12.694 / 40.011
Ta.30495.1.A1_s_at / CBFIVc-14.1 / CK214893 / 12.1 / 6.607
TaAffx.129134.2.S1_at / Glycosyltransferase / CA641144 / 11.685 / 2.831
TaAffx.92008.1.A1_s_at / Phenylalanine ammonia-lyase / CK163994 / 11.323 / 5.862
Ta.2781.1.S1_at / AP2/EREBP type transcription factor / AF376136.1 / 11.071 / 4.79
Ta.24748.1.S1_at / Na+/H+ antiporter / AY040246.2 / 10.503 / 5.522
Ta.2793.1.S1_at / Multidrug resistance protein 1 homolog / AB055077.1 / 10.293 / 4.055
Ta.4334.3.A1_a_at / Calcium-dependent protein kinase / CA706222 / 10.028 / 2.071
Ta.1258.2.S1_x_at / S-adenosyl-L-homocysteine hydrolase / BJ317864 / 9.941 / 11.301
Ta.28219.1.A1_at / Glutathione transferase / CA698466 / 9.834 / 18.045 / Contig1589_s_at / down
Ta.7151.1.S1_at / Fructan exohydrolase / BJ321663 / 9.182 / 8.047
Ta.124.1.S1_x_at / Dehydrin / CK196594 / 9.112 / 17.39 / HVSMEa0006I22r2_s_at / up
Ta.28734.1.S1_x_at / Glycine-rich RNA-binding protein / CA725382 / 8.554 / 24.132 / HVSMEh0088I08r2_s_at / down
Ta.1258.1.S1_a_at / S-adenosyl-L-homocysteine hydrolase / L11872.1 / 8.272 / 9.171
TaAffx.1024.1.A1_at / CBFIIId-A19 /// CBFIIId-B19 / CK216413 / 8.019 / 2.888
Ta.28613.1.S1_at / Cold acclimation protein WCOR726 / U73213.1 / 7.936 / 14.497
Ta.2882.1.S1_s_at / EF-hand Ca2+-binding protein CCD1 / AF181661.1 / 7.278 / 11.873
TaAffx.92008.1.A1_at / Phenylalanine ammonia-lyase / CK163994 / 7.115 / 6.329
Ta.1991.1.S1_at / Cold acclimation protein WCOR410c / BJ264076 / 7.004 / 8.889
Ta.13255.1.S1_at / Dehydrin WZY1-1 / CK163939 / 6.639 / 18.825
Ta.18487.2.S1_at / Cold-responsive protein / CA711116 / 6.636 / 120.471
Ta.4678.2.S1_at / WRKY8 transcription factor / CK163938 / 6.39 / 9.82
Ta.7378.21.S1_at / Histone H2B / BJ310041 / 6.214 / 2.354 / Contig1177_at / down

Continued Supplementary Table S2

Probe set ID / Functional description / Represent sequence ID / Ratio (1 d) / Ratio (3 d) / Subzero acclimation1 / Freeze in barley2
Probe set ID / up/
down / Probe set ID / up/
down
Ta.28539.1.A1_x_at / NAC domain transcription factor / BJ286857 / 6.172 / 11.46
Ta.122.1.S1_x_at / Cold acclimation protein WCOR410b / U73210.1 / 6.022 / 8.455
Ta.3760.2.A1_a_at / Beta 1,3-glucanase / CD935459 / 5.985 / 3.851
Ta.28351.1.S1_at / Adenosine diphosphate glucose pyrophosphatase / CK215324 / 5.787 / 8.306
Ta.23679.1.S1_at / Protein phosphatase 2C / BQ807036 / 5.776 / 3.688
Ta.20401.1.S1_at / Shaggy-like kinase / BJ261212 / 5.739 / 2.935
Ta.759.1.S1_at / Cold acclimation protein WCOR413 / U73216.1 / 5.717 / 41.097 / Contig3112_at / down
Ta.28351.1.S1_s_at / Adenosine diphosphate glucose pyrophosphatase / CK215324 / 5.572 / 7.198
Ta.21262.1.A1_at / Xylanase inhibitor TAXI-III / CA642917 / 5.541 / 29.531
Ta.123.1.S1_x_at / Cold acclimation protein WCOR80 / U73212.1 / 5.444 / 129.262
Ta.4678.1.S1_x_at / WRKY8 transcription factor / CD935984 / 5.414 / 15.866
Ta.2638.1.S1_at / Rab protein / X62476.1 / 5.383 / 44.785
Ta.5367.1.S1_s_at / NAC domain transcription factor / CK193816 / 5.371 / 10.674
Ta.30631.1.S1_at / S-like RNase / AY517470.1 / 5.344 / 2.256
Ta.21262.1.A1_x_at / Xylanase inhibitor TAXI-III / CA642917 / 5.226 / 28.146
Ta.4678.1.S1_at / WRKY8 transcription factor / CD935984 / 5.177 / 17.649
Ta.21766.1.S1_at / PTACR7 / CK214787 / 5.144 / 71.296
Ta.28351.1.S1_x_at / Adenosine diphosphate glucose pyrophosphatase / CK215324 / 5.123 / 7.229
Ta.236.1.S1_at / MAP kinase homolog / AF079318.1 / 4.962 / 4.478 / Contig8078_at / down
Ta.2882.1.S1_at / EF-hand Ca2+-binding protein CCD1 / AF181661.1 / 4.874 / 6.076
Ta.7151.1.S1_x_at / Fructan exohydrolase / BJ321663 / 4.758 / 3.11
Ta.794.1.S1_at / QM / CK171366 / 4.601 / 9.746
Ta.25469.1.S1_at / Cytochrome P450 / AY437442.1 / 4.523 / 4.322 / HU13P05r_at / up / Contig15786_at / down
Ta.22967.1.S1_x_at / pSBGer4 protein / CA690832 / 4.386 / 14.351
Ta.21350.1.S1_x_at / Wali5 protein / L11882.1 / 4.367 / 20.485
Ta.2791.1.S1_at / Temperature stress-induced lipocalin / BJ251528 / 4.257 / 6.172
Ta.209.1.S1_at / S222 protein / AF031231.1 / 4.058 / 2.293 / Contig8749_at / down
TaAffx.10868.1.A1_at / MIKC-type MADS-box transcription factor WM24B / BJ230548 / 4.057 / 3.594
Ta.2551.1.S1_at / Protein kinase / BE492852 / 3.941 / 5.552
Ta.706.1.S1_s_at / Glucose-6-phosphate dehydrogenase / AB029454.1 / 3.899 / 10.55 / Contig9121_at / up
Ta.23176.1.S1_at / Protein phosphatase 2C / CK208784 / 3.879 / 2.796
Ta.106.1.A1_at / Early light-inducible protein / AB019617.1 / 3.857 / 2.554
Ta.4334.1.S1_at / Calcium-dependent protein kinase / CK205841 / 3.826 / 2.602
Ta.23758.1.S1_x_at / Cold acclimation protein WCOR518 / U73214.1 / 3.814 / 14.25
Ta.24254.3.S1_x_at / Ribosomal protein S29 / CA681727 / 3.591 / 0.474
TaAffx.6606.1.S1_at / MADS-box transcription factor TaAGL33 / CA658343 / 3.53 / 3.285
Ta.1347.1.S1_at / GTPase SAR1 / CA704375 / 3.463 / 5.789
Ta.2780.1.S1_at / NADPH-thioredoxin reductase / BJ219268 / 3.452 / 9.269
Ta.6301.2.S1_x_at / Calcium-dependent protein kinase 2 / CA630162 / 3.422 / 4.908
Ta.234.1.S1_at / Low-affinity cation transporter / AF015523.1 / 3.404 / 6.964
Ta.6556.1.S1_at / 14-3-3 protein / AF548740.1 / 3.337 / 2.019
Ta.5856.1.S1_at / PTF1 / CD374119 / 3.33 / 2.748
Ta.1138.1.S1_at / Cold-responsive LEA/RAB-related COR protein / AF255053.1 / 3.301 / 5.425

Continued Supplementary Table S2

Probe set ID / Functional description / Represent sequence ID / Ratio (1 d) / Ratio (3 d) / Subzero acclimation1 / Freeze in barley2
Probe set ID / up/
down / Probe set ID / up/
down
Ta.4834.1.S1_at / Ornithine/acetylornithine aminotransferase / BQ803694 / 3.241 / 40.333
Ta.4908.1.S1_at / Glycosyltransferase / CA602132 / 3.221 / 3.17
Ta.746.3.S1_x_at / Translation initiation factor / BJ318989 / 3.176 / 2.623
Ta.14168.1.S1_at / Proline-rich protein / BJ263863 / 3.111 / 6.54
Ta.794.1.S1_x_at / QM / CK171366 / 3.057 / 4.837
Ta.746.1.S1_a_at / Translation initiation factor / AF508969.1 / 3.043 / 2.327
Ta.3679.1.S1_x_at / Glutathione transferase / CA733231 / 3.036 / 3.408
TaAffx.120885.1.S1_s_at / S-adenosylmethionine decarboxylase precursor / CA694004 / 3.027 / 0.496 / Contig309_s_at / up
Ta.1071.1.S1_at / Glutaredoxin / AF542185.1 / 3.016 / 6.646
Ta.207.1.S1_at / S276 protein / AF031194.1 / 3.003 / 7.536
Ta.30944.1.S1_s_at / Glutathione transferase F2 / AJ440791.1 / 2.999 / 0.379
TaAffx.49997.3.S1_s_at / Cryptochrome 2 / CA744881 / 2.978 / 13.596 / AF348460_at / up
Ta.4678.3.S1_x_at / WRKY8 transcription factor / CK215282 / 2.912 / 5.036
Ta.5011.1.S1_at / Protein kinase / CK207059 / 2.91 / 2.783
Ta.5174.2.S1_at / Nar2.1 protein / CK193743 / 2.899 / 7.618
Ta.1071.1.S1_x_at / Glutaredoxin / AF542185.1 / 2.855 / 5.846
Ta.5855.3.S1_a_at / FCA-A1 / AY230320.1 / 2.773 / 4.399
Ta.9097.1.S1_x_at / Glutathione peroxidase-like protein / BJ254939 / 2.739 / 2.88 / Contig2454_at / up
Ta.7443.1.S1_at / Protein serine/threonine kinase-like / CK153462 / 2.711 / 6.319
Ta.135.1.S1_at / Reversibly glycosylated polypeptide / BJ230302 / 2.692 / 4.193
Ta.28852.1.S1_at / ETTIN-like auxin response factor / AY376128.1 / 2.689 / 3.527
Ta.681.2.S1_a_at / Ferritin 1A /// ferritin 1B / CK197459 / 2.678 / 2.599
Ta.4725.1.S1_at / WRKY transcription factor / CK195830 / 2.674 / 12.074
Ta.6492.3.S1_s_at / Vacuolar proton ATPase subunit E / BJ220894 / 2.615 / 0.318
Ta.15229.1.S1_at / Cryptochrome 2 / CA747122 / 2.601 / 8.532 / AF348460_at / up
Ta.27401.2.S1_x_at / 60s ribosomal protein L21 / BQ294638 / 2.539 / 3.479
Ta.26928.1.S1_a_at / Fructan exohydrolase / CD454795 / 2.52 / 6.005
Ta.74.1.S1_at / Protein disulfide isomerase 2 precursor / AF262980.1 / 2.513 / 4.099
Ta.231.1.S1_x_at / Secretory protein / AF079526.1 / 2.494 / 4.778
Ta.26928.2.S1_x_at / Fructan exohydrolase / AJ611876 / 2.494 / 6.54
Ta.27448.1.S1_s_at / Cyc07 / AF542188.1 / 2.466 / 6.169
Ta.2541.1.S1_x_at / Cold acclimation protein WCOR615 / U73217.1 / 2.464 / 3.042 / Contig4520_at / up
Ta.9421.1.S1_at / Basic region/leucine zipper protein / CA620843 / 2.413 / 2.889
TaAffx.46097.1.S1_at / Rab protein / CD900463 / 2.355 / 2.609
Ta.26928.1.S1_x_at / Fructan exohydrolase / CD454795 / 2.305 / 4.558
Ta.5428.1.S1_at / Acyl transferase 3-like / BU100019 / 2.292 / 5.801
Ta.9622.3.S1_a_at / DEAD-box ATPase-RNA-helicase / BJ278119 / 2.287 / 2.719
TaAffx.82926.1.S1_s_at / Glutathione transferase / CA664790 / 2.259 / 8.406
Ta.4601.2.S1_at / Beta-glucosidase / BJ310258 / 2.227 / 2.071 / rbah29m06_s_at / down
Ta.24663.1.S1_s_at / Glycosyltransferase / BJ296162 / 2.226 / 2.491
Ta.2153.1.S1_s_at / Ribosomal protein L30 / CK165194 / 2.221 / 5.62
Ta.3070.1.S1_a_at / Mitogen-activated protein kinase 2 / BJ229772 / 2.2 / 2.471
Ta.796.1.S1_x_at / Protein disulfide isomerase / AF262981.1 / 2.195 / 4.752

Continued Supplementary Table S2

Probe set ID / Functional description / Represent sequence ID / Ratio (1 d) / Ratio (3 d) / Subzero acclimation1 / Freeze in barley2
Probe set ID / up/
down / Probe set ID / up/
down
Ta.24130.1.S1_x_at / 60S ribosomal protein L15 / BU101253 / 2.193 / 5.322
Ta.14528.1.S1_at / Histone deacetylase HDAC2 / BJ308556 / 2.186 / 3.649
Ta.5298.1.A1_at / Dehydration responsive element binding protein / CD454920 / 2.186 / 2.099
Ta.1989.3.S1_s_at / Glucose-6-phosphate dehydrogenase / CA679732 / 2.17 / 0.466
Ta.222.1.S1_at / Small GTP-binding protein / AF112964.1 / 2.151 / 3.839 / HU02C06u_at / up
Ta.22579.1.S1_at / Glycosyltransferase / CA647988 / 2.12 / 3.667
Ta.435.1.S1_at / Betaine-aldehyde dehydrogenase / AY050316.1 / 2.115 / 2.661
Ta.23429.1.S1_at / Ribosomal protein S7 / CK203896 / 2.099 / 5.325
Ta.39.3.S1_x_at / Starch branching enzyme I / BJ283967 / 2.094 / 5.671
Ta.1317.1.S1_at / Initiation factor (iso)4F p28 subunit / M95818.1 / 2.068 / 3.439
Ta.14635.1.S1_a_at / Ribosomal Pr 117 / AF479048.1 / 2.05 / 4.267
Ta.39.3.S1_a_at / Starch branching enzyme I / BJ283967 / 2.041 / 5.512
Ta.3070.1.S1_x_at / Mitogen-activated protein kinase 2 / BJ229772 / 2.034 / 2.028
Ta.21342.1.S1_x_at / Chitinase 3 / AB029936.1 / 2.025 / 39.003 / Contig5995_at / up
Ta.6229.1.S1_at / Multidomain cystatin / AL829976 / 2.022 / 4.264
Ta.260.1.S1_at / RNA-binding protein / AF315811.1 / 2.013 / 5.086
Ta.14635.2.S1_a_at / Ribosomal Pr 117 / BJ225605 / 2.01 / 5.262
Ta.3795.1.S1_x_at / Chlorophyll a/b-binding protein WCAB precursor / U73218.1 / -15.385 / -35.714 / Contig628_x_at / up
Ta.20429.1.S1_at / Phenylalanine ammonia-lyase / CK197611 / -7.407 / -9.615
Ta.639.1.S1_at / Peptidylprolyl isomerase / CA713572 / -6.061 / -8.264 / Contig1690_s_at / down
Ta.25025.1.S1_x_at / Em protein / CD490538 / -5.525 / -3.472
Ta.6812.1.S1_at / FD-like 15 protein / BJ310152 / -5.025 / -6.711
Ta.6869.1.S1_at / ADP-glucose pyrophosphorylase small subunit / CD885283 / -4.717 / -8.621
Ta.21348.1.S1_s_at / Sulfur-rich/thionin-like protein /// sulfur-rich/thionin-like protein / U32429.1 / -4.386 / -10.526
Ta.21348.2.S1_at / Sulfur-rich/thionin-like protein /// sulfur-rich/thionin-like protein / AY253444.1 / -4.386 / -14.706
Ta.96.1.S1_at / Ubiquitin carrier protein / M28059.1 / -4.255 / -4.016 / Contig1040_at / down
Ta.28069.1.A1_at / LSD1-type zinc finger protein / CD454289 / -4.184 / -12.5 / Contig6358_at / up
Ta.191.1.S1_at / Thiol protease / U32430.1 / -4.098 / -13.158
TaAffx.66606.1.A1_at / Plasma membrane intrinsic protein / BG909021 / -4.098 / -10
Ta.21348.1.S1_x_at / Sulfur-rich/thionin-like protein / U32429.1 / -3.861 / -10.309
Ta.350.1.A1_s_at / CBFIIIa-6.2 / CD492203 / -3.759 / -3.69
Ta.1404.1.S1_at / Ribulose bisphosphate carboxylase activase B / AF251264.1 / -3.65 / -6.849
TaAffx.42397.1.A1_at / Receptor-like kinase protein / AY584533.1 / -3.65 / -2.283
Ta.14572.1.S1_at / Isopentenyl pyrophosphate isomerase / BJ323156 / -3.61 / -5.814
Ta.1848.2.S1_s_at / Aquaporin 1:2 / BJ230034 / -3.546 / -38.462 / Contig19393_at / down
Ta.27661.1.S1_at / Heat shock protein 16.9 / AJ614980 / -3.484 / -4.132
Ta.25025.1.S1_at / Em protein / CD490538 / -3.436 / 3.448
Ta.21038.1.S1_at / Ammonium transporter / CA601803 / -3.322 / 6.897
Ta.1848.2.S1_x_at / Aquaporin 1:2 / BJ230034 / -3.3 / -47.619
Ta.27312.1.S1_x_at / Ammonium transporter / BT009318.1 / -3.185 / -7.353
Ta.5249.1.A1_at / Early nodule-specific-like protein ENOD8 gene / BJ254773 / -3.155 / -5.376
Ta.1082.3.S1_at / Delta-type tonoplast intrinsic protein / AY525640.1 / -2.89 / -8.403

Continued Supplementary Table S2