Supplementary Table 2: List of synthetic promoters covered under this review
Synthetic promoter / cis-elementsinvolved / Nature of the promoter / References
4 x W2,
4 x W1,
4 x D,
4 x GCC,
4 x S,
4 x JERE,
4 x GST,
4 x DRE,
4 x W2/4 x S,
4 x W2/2 x S/2 x D / W- box [(T)TGAC(C/T)]
D- box (GGAACC)
GCC box (AGCCGCC)
JERE(AGACCGCC)
DRE (TACCGACAT)
Box S (AGCCACC)
Gst-1 box (Box S and W-box) / Pathogen/ wound/ elicitor-inducible / (Rushton et al. 2002)
CMPG1 / Pathogen-responsive element F
(Three W-box core motifs; two W-box cores with one D box motif in between; two W-box cores with the CATTCAAC sequence in between) / Pathogen-inducible / (Heise et al. 2002)
4 x PR1,
4 x SARE,
4 x JAR,
4 x ERE / PR1-motif (ACGTCATAGATGTGGCGGCA
TATATTCTTCAGGACTTTTC), SARE (TTCGACCTCC), JAR (TTCGACCTCC and ACGTG), ERE (AGCCGCC) / Pathogen-inducible / (Mazarei et al. 2008)
(Liu et al. 2011)
Xa27/Bs3,
Bs3-E/Bs3,
Bs3-E/Xa27/Bs3 / UPTAvrBs3Δrep16, UPTAvrXa27, and
UPTAvrBs3 boxes / Pathogen-inducible / (Romer et al.
2009)
EE,
FF,
FFEE / E17 and F
( Two W- box motifs) / Pathogen-inducible / (Shokouhifar et al. 2011)
4D, 2S2D / 4D and 2S2D
D- box (GGAACC)
Box S (AGCCACC) / Elicitor-responsive / (Niemeyer et al. 2014)
C18, C19, C20, C21,C22, C23, C24, C25, C26, C27, C28, C29 / ACGT box (GTACGTGGCGC), CE1 (TGCCACCGG) or CE3 (ACGCGTGTCCTC) / Stress/ abscissic acid (ABA)-responsive / (Shen et al. 1996)
4 x C/DRE-GUS / DRE/C-repeat
(GCCGAC) / Cold/drought-
Inducible / (Kim et al. 2002)
EKCM, EKCRM, ECCRM / DRE/CRT element (A/GCCGAC), DRE (TACCGAC),
ABRE (ACGTGG/TC) of
erdI, kinI, cor15a, rd29A promoters / Dehydration, high salt, cold stress-inducible / (Hou et al. 2012)
4 x GT-1/as-1(-90)
4 x GT-1/as-1(-65) / GT-1 box (GTGTGGTTAATATG)
as-1 element / Light- inducible / (Gilmartin et al. 1990)
4 × GT1, 4 × GATA, 4 × G, 2 × Z / GT1 box, GATA motif, G-box, and Z-box of Arabidopsis light-regulated photosynthetic genes (cab, rbcS) promoters / Light- inducible / (Puente et al. 1996)
GT1-NOS101, Z-NOS101, G-NOS101,GATA-NOS101,G/GATA-NOS101,GT1/GATA-NOS101, Z/GATA-NOS101 / Four LREs: GT1 (GTGTGGTTAATATG), Z (ATCTATTCGTATACGTGTCAC), G (TGACACGTGGCA), GATA (AAGATAAGATT)
and
NOS101 / Light and development / (Puente et al. 1996),
(Chattopadhy-ay et al. 1998)
PcCHS-m1, PcCHS-m2, PcH3–7, PcH3–7m / ACE/ MRE-containing light-regulatory unit (ACGT containing element) of PcACO promoter / UV-light and elicitor / (Logemann and Hahlbrock 2002)
CaMV 35S2 / Duplicated enhancer of CaMV 35S promoter / Constitutive / (Kay et al. 1987)
Mac / CaMV 35S (-90 to -941), Nopaline synthase (-301 to +65) / Constitutive, wound-inducible / (Comai et al. 1990)
pEmuGN / Anaerobic Responsive Element (ARE: GGTTT) and
ocs-element / Constitutive / (Last et al. 1991)
pJIT167,
pJIT169,
pJIT166 / Duplicated CaMV 35S promoter fused to
a polylinker preceded by the CCACCATGG and AACAATGG sequences / Constitutive / (Guerineau et al. 1992)
Amas'AocsPocs, (Aocs)3AmasPmas, (Aocs)3Pmas,
AocsAmasPmas,
AocsPocs, Amas'Pocs,
Amas"AocsPocs / Mannopine and Octopine synthase gene promoters / Constitutive / (Ni et al. 1995)
pKPLP36GUS / Peanut Chlorotic Streak Virus / Constitutive / (Maiti and Shepherd 1998)
G-box 10/–90 / Four tandemly repeated G-box 10 motifs ( GCCGCC) and CaMV –90/35S region / Constitutive / (Ishige et al. 1999)
M24, M26 / Double enhancer domains of MMVFlt / Constitutive / (Dey and Maiti 1999)
Mod2A1T, Mod3A1T / CaMV 35S / Constitutive / (Bhullar et al. 2003)
Pcec, Pmec / Transcription activation module (TAM)
designed from a database of highly
expressed plant genes / Constitutive / (Sawant et al. 2001), (Sawant et al. 2005), (Koul et al. 2012)
Superpromoter
pMSP-1, pMSP-2, pMSP-3 / Trimer of the ocs activator fragment, mas2’ activator-promoter region of Agrobacterium pTiA6 / Constitutive / (Lee et al. 2007)
SynPro3, SynPro5 / Short directly-repeated (DR) DNA enhancer elements from Geminivirus, Nanoviruses, Badnaviruses and Caulimoviruses / Constitutive / (Cazzonelli and Velten 2008)
pOCSn-OCS, pLOCSn-OCS, pΔOCS, pLOCSΔOCS / Ocs element of Octopine synthase promoter / Constitutive / (Liu and Bao 2009)
VR-ACS1 / Vigna aminocyclopropane-1- carboxylate synthase gene promoter / Constitutive / (Wever et al. 2010)
MSgt-FSgt / UAS of MMVSgt and Core domain of FMVSgt / Constitutive / (Kumar et al. 2011)
FS3-UAS-3X, FS3-UAS-2X / FMVSgt / Constitutive / (Ranjan et al. 2011)
FuasFScp, FSuasFcp / FMVFlt and FMVSgt / Constitutive / (Ranjan et al. 2012)
FS-(TGACG), FS-(TGACG)2, FS-(TGACG)3 / TGACG motif of F-Sgt promoter / Constitutive, salicylic acid (SA) inducible / (Kumar et al. 2012)
FSgt-PFlt, MSgt-PFlt / FMVSgt and PClSVFlt / Constitutive, ABA and SA- inducible / (Acharya et al. 2014a)
MUASMSCP / MMVFlt and MMVSgt / Constitutive / (Acharya et al. 2014b)
4H1-46, 4H3-46 / Tetrameric hex-1and hex-3 elements of histone gene promoter / Tissue-specific and
desiccation-, salinity- and
ABA-inducible / (Lam and Chua 1991)
pTS21, pTS22,
pTS23, pTS24 / CaMV 35S promoter, anther box, chsA trailer / Tissue-specific / (van der Meer et al. 1992)
Construct 7 and 8 of RTBV / Box II, the ASL Box and the GATA motif / Tissue-specific / (Yin et al. 1997)
AP3::GUS trimer / Tandem repeat of a 143 base pair segment containing three CArG boxes / Tissue-specific / (Tilly et al. 1998)
E4-E8 / E4 (-1150 to +16) and E8 (-2257 to -847) gene promoter / Tissue-specific / (Bestwick et al 2000)
pJSS-7, pJSS-8 / Untranslated leader sequence of an alfalfa mosaic virus (AMV) RNA4, E8 promoter, CaMV 35S promoter / Tissue-specific / (Krasnyanski et al. 2001)
pBdENP, pBENII / -465/-85 of the promoter fragment
NPII, doubled CaMV 35S enhancer / Tissue-specific / (Guo et al. 2004)
A9(275)TA29(330) / A9 and TA29 / Tissue-specific / (Bisht et al. 2004)
6 x MYB46–SNBE1 / SNBE / Tissue-specific / (Zhong et al. 2007)
A27znGlb1 / Pb1, Pb2, Pb3/ GZM, Pb4 motifs of Maize 27zn and Em1a, Em1b, Em2 motifs of Glb1 promoter / Tissue
-specific / (Shepherd and Scott 2009)
pmGR1, pmGR2 / -989 to -959 and and -466 to -425 of promoter of large subunit of ADP-glucose pyrophosphorylase and CaMV 35S / Tissue-specific / (Yin et al. 2009)
2x::GUS, 4x::GUS, -148-3’:: GUS, -137-3’::GUS / 57 bp fragment of AtMYB60 promoter
And CaMV35S promoter / Tissue-specific / (Cominelli et al. 2011)
EFCFS, EFCFS-HS-1, EFCFS-HS-2 and EFCFSHS-3 / FUAS of F20 and core promoter of FS3,
AAAG motif of EFCFS, / Tissue-specific/SA and jasmonic acid (JA) inducible / (Ranjan and Dey 2012)
pCL, pLC / CRT/DRE element (CCGAC) and TSSR of Arabidopsis cor15a promoter and potato class I patatin promoter / Tissue-specific, cold-inducible / (Li et al. 2013)
p35S- PCHS - Ω, p35S- LCHS – Ω, pOCS- PCHS - Ω and pOCS- LCHS – Ω / 35S or OCS enhancer fused to a 302 bp CHSA core promoter fragment from petunia (PCHS) or a 307 bp CHS core promoter fragment from lily ( LCHS), and containing an omega element (Ω) / Tissue-specific / (Du et al. 2014)
proA, proA1, proB / African cassava mosaic virus (ACMV)
DNA A and B promoters / Bidirectional, constitutive / (Frey et al. 2001)
pd35GR, pd35ER,
pdCGR, pq35GR / CaMV 35S or CsVMV / Bidirectional, constitutive / (Li et al. 2004)
pBDGG / CaMV 35S / Bidirectional, constitutive / (Zhang et al. 2008)
P1301A; P1301B / Transcription activation module (TAM)
designed from a database of highly
expressed plant genes / Bidirectional salicylic
acid-, salinity- and
IAA-inducible / (Chaturvedi et al. 2006)
pGLbd1, pGLbd2, pGLbd3, pGLbd4, pGLbd5, pGLbd6 / CaMV 35S, PClSV , or OPR1 promoters / Bidirectional, constitutive
or wounding-, JA-, and
leaf senescence-inducible / (Xie et al. 2001)
mPtDrl02 / Methyl jasmonate inducible synthetic promoter derived from PtDr102 and CaMV 35S / Bidirectional, methyl jasmonate inducible / (Zheng et al. 2011)
FUAS35SCP, MUAS35SCP / FMVFlt, MMVFlt and CaMV35S / Bidirectional, constitutive / (Patro et al. 2013)
Triple-Op / CaMV 35S, 19 bp palindromic three tet operator / Tetracycline-inducible / (Gatz et al. 1992)
pCAR46C / H-box (CCTACC(N)7CT) and the G-box (CACGTG) of chsl5 gene promoter / p-coumaric acid (4-CA) / (Loake et al. 1992)
pTetVp16, pTopl0,
pTetVP16-Top10,
pNosxTetVP16-Top10 / CaMV 35S, seven tet operator / Tetracycline-inducible / (Weinmann et al. 1994)
CGEcR, VGEcR / European corn borer ecdysone receptor / Methoxyfenozide inducible / (Unger et al. 2002)
pOp/LhGR / Op6, that carries six copies of an optimized lac operator sequence / Dexamethasone inducible / (Samalova et al. 2005)
XRE-P / Six repeated XRE sequences fused to CaMV 35S promoter / Dioxin (3-methyl- cholanthrene (MC), β-naphthoflavone (βNF), and indigo)- inducible / (Kodama et al. 2007)
4xNRE-min-GUS / Four copies of the 43-bp sequence of NIR1 promoter, CaMV 35S / Nitrate responsive / (Konishi and Yanagisawa 2010)
4 x SARE, 4 x JERE, 4 x GCC, 4 x GST1, 4 x HSRE and 2 x W-box / W- box [(T)TGAC(C/T)]
D- box (GGAACC)
GCC box (AGCCGCC)
JERE(AGACCGCC)
Gst-1 box (Box S and W-box) / Probenazole-inducible / (Zhu et al.
2014)
Rab 2x (-188 to -158),
Rab 6x (-181 to -171)
Amy 1x (-189 to -120),
Amy 6x (-148 to -128). / ACGT element (GTACGTGGCGC) of Rab 16A and GA3 response element (GGCCGATAACAAACTC
CGGCC) of Amy 1/6-4 / ABA-/Gibberellic acid- responsive / (Skriver et al.1991)
Oligo1/Am(-41)IGN,
Oligo2/Am(-41)IGN,
Oligo3/Am(-41)IGN / Oligos spanning various domains of the GA hormone-responsive region between -174 and -41 were fused upstream of a truncated a-amylase promoter AmlGN construct / ABA-/Gibberellic acid- responsive / (Gubler and Jacobsen 1992)
RB70, RB40 / AGTACGTGGC and GG/CCGCGCT
motifs of rab16B promoter and -46 CaMV 35S promoter / ABA-responsive / (Ono et al. 1996)
DR5(8×) / Soybean GH3 promoter / Auxin-inducible / (Ulmasov et al. 1997)
TCS / B-type Arabidopsis response regulator (ARR)-binding motifs and minimal 35S / Cytokinin-inducible / (Muller and Sheen 2008)
(ACGT)-50+Pmec, (ACGT)2-50+Pmec, (ACGT)N5(ACGT)-50+Pmec, (ACGT)N10(ACGT)-50+Pmec, (ACGT)N25(ACGT)-50+Pmec / Single or two
copies of the activator motif ACGT, Pmec minimal promoter / Salicylic acid/ abscissic acid inducible / (Mehrotra and Mehrotra 2010)
2×ABRE, 4×ABRE / Wheat Em gene promoter / Salinity/abscisic acid-
Inducible / (Ganguly et al. 2011)