Supplementary Table 1. List of K. marxianus strains used in this study

Strain name / Genotype / Reference
Km05u / a ura3Δ mutant strain derived from K. marxianus KCTC 17555 (CBS 6556= ATCC 26548) / (Lee KS et al, 2013)
Km05ku80Δ / ura3Δ ku80::hisG-ScURA3-hisG / this study
Km05ku80Δ-u / ura3Δ ku80::hisG / this study
Km05ku80pdc1Δ / ura3Δ ku80::hisG pdc1:::hisG-ScURA3-hisG / this study
Km05ku80Δpdc5Δ / ura3Δ ku80::hisG pdc5:::hisG-ScURA3-hisG / this study
Km05ku80Δleu2Δ / ura3Δ ku80::hisG leu2:::hisG-ScURA3-hisG / this study
Km05ku80Δleu2Δ-u / ura3Δ ku80::hisG leu2:::hisG / this study

Supplementary Table 2. List of plasmids used in this study

Plasmid name / Description / Reference
pKI / E. coli and S. cerevisiae shuttle vector containing an ampicillin resistance marker and a hisG-ScURA3-hisG blaster cassette / (Heo P et al, 2013)
pKI-KU80DsU2 / pKI containing a Kmku80::hisG-ScURA3-hisG disruption cassette with a 1,000 bp homologous flanking sequence / this study
pKI-KmPDC1DU53 / pKI containing the Kmpdc1::hisG-ScURA3-hisG disruption cassette with a 1,000 bp homologous flanking sequence / this study
pKI-KmPDC5DU2 / pKI containing the Kmpdc5::hisG-ScURA3-hisG disruption cassette with a 1,000 bp homologous flanking sequence / this study
pKI-KmLEU2DU2-50 / pKI containing the Kmleu2:hisG-ScURA3-hisG disruption cassette with a 50 bp homologous flanking sequence / this study
pKI-KmLEU2DU2-100 / pKI containing the KmLEU2 disruption cassette with a 100 bp homologous flanking sequence / this study
pKI-KmLEU2DU2-250 / pKI containing the KmLEU2 disruption cassette with a 250 bp homologous flanking sequence / this study
pKI-KmLEU2DU2-500 / pKI containing the KmLEU2 disruption cassette with a 500 bp homologous flanking sequence / this study
pKI-KmLEU2DU2-1000 / pKI containing the KmLEU2 disruption cassette with a 1,000 bp homologous flanking sequence / this study

Supplementary Table 3. List of primers used in this study

Primer name / Sequence / Description
KmKU80_1F_Xho / GCACTCGAGTTTGCACCAGGCCTTGTC / Forward primer for amplification of 1,000 bp KmKU80 5′-UTR
KmKU80_2B_Eco / ACTGAATTCAAACGCTGTGAGCTGGGA / Reverse primer for amplification of 1,000 bp KmKU80 5′-UTR
KmKU80_3F_Bam / AGTGGATCCCTAATTGTATACCTGGGGC / Forward primer for amplification of 1,000 bp KmKU80 3′-UTR
KmKU80_4B_Sac / TGAGAGCTCGTCGAGGAATTGCTTGATC / Reverse primer for amplification of 1,000 bp KmKU80 5′-UTR
KmPDC1_5D_1F_Xho / GATCTCGAGCCGAAAGATCGTCCGATT / Forward primer for amplification of 1,000 bp KmPDC1 5′-UTR
KmPDC1_5D_2B_Bgl / CTAAGATCTTGCAATTATTTGGTTTGGGTG / Reverse primer for amplification of 1,000 bp KmPDC1 5′-UTR
KmPDC1_3D_3F_Xba / GCATCTAGAAGAGGGAGAGGATAAAGAG / Forward primer for amplification of 1,000 bp KmPDC1 3′-UTR
KmPDC1_3D_4B / TCGTCTTCTCAGCTGCAA / Reverse primer for amplification of 1,000 bp KmPDC1 3′-UTR
Km05PDC6D_1F / CGTACTCGAGCCGGTGAGTCAAAGATCG / Forward primer for amplification of 1,000 bp KmPDC5 5′-UTR
Km05PDC6D_2B / GATCGAATTCAGCTGATACCCCACCCTT / Reverse primer for amplification of 1,000 bp KmPDC5 5′UTR
Km05PDC6D_3F / CGATACTAGTGAACTTACTCCTCAAAGC / Forward primer for amplification of 1,000 bp KmPDC5 3′-UTR
Km05PDC6D_4B / CAGTGAGCTCATCGTGCTATCTTCCATG / Reverse primer for amplification of 1,000 bp KmPDC5 3′-UTR
Km05LEU2-5UTR_1F / CATGCTCGAGATGATGCCGTAATCAACAC / Forward primer for amplification of a 1,000 bp 5′-fragment of KmLEU2
Km05LEU2-5UTR_2B / GTACAGATCTTGATGCCAAGACATTTGC / Reverse primer for amplification of a 1,000 bp 5′fragment of KmLEU2
Km05LEU2-3UTR_3F / GTACACTAGTGGCTTTGACTCTAAGATTAC / Forward primer for amplification of a 1,000 bp 3′-fragment of KmLEU2
Km05LEU2_3UTR_4B / TGCAGAGCTCGTGAAGCTGCTAGGCTAA / Reverse primer for amplification of a 1,000 bp 3′-fragment of KmLEU2
Km05Leu2-500_1FX / CATGCTCGAGAAGCACGCCCTTCTATCA / Forward primer for amplification of a 500 bp 5′-fragment of KmLEU2
Km05Leu2+521_4BS / TGCAGAGCTCCAGAGCTTCTAAATACTCTG / Reserve primer for amplification of a 500 bp 3′-fragment of KmLEU2
Km05Leu2-261_1FX / CATGCTCGAGGCTTCAGACTCTTTGCTTG / Forward primer for amplification of a 250 bp 5′-fragment of KmLEU2
Km05Leu2+269_4BS / TGCAGAGCTCGATATGCATACGCTTAATAACG / Reserve primer for amplification of a 250 bp 3′-fragment of KmLEU2
Km05Leu2-99_1FX / CATGCTCGAGGAAGTTCAAAGAATCACCA / Forward primer for amplification of a 100 bp 5′-fragment of KmLEU2
Km05Leu2-50_1FX / CATGCTCGAGACCCACCTTTACCAATCT / Forward primer for amplification of a 50 bp 5′-fragment of KmLEU2
ScURA3_2B_48 / TTAGTTTTGCTGGCCGCA / Reverse primer for amplification of 100 bp and 50 bp 5′-fragments of KmLEU2
ScURA3_1F_47 / ATGTCGAAAGCTACATATAAG / Forward primer for amplification of 100 and 50 bp 3′-fragments of KmLEU2
Km05Leu2+103_4BS / TGCAGAGCTCCCGGAACCTAGTTTATGT / Reverse primer for amplification of a 100 bp 3′-fragment of KmLEU2
Km05Leu2+50_4BS / TGCAGAGCTCCAGCATTGAATTATTTCGTAAT / Reverse primer for amplification of a 50 bp 3′-fragment of KmLEU2

Supplementary Fig. 1 Phylogenetic tree analysis of eukaryotic Ku80 proteins including K. marxianus Ku80. A phylogeny was calculated using the CLUSTAL W method of the DNASTAR MegAlign program. Ku80 amino acid sequences : Aspergillus niger (CAK48968.1), Arabidopsis thaliana (AEE32242.1), Candida albicans (XP_713216.1), Cryptococcus neoformans (XP_777203.1), Drosophila melanogaster (AAF63744.1), Hansenula polymorpha (ESW97400.1), Homo sapiens (AAA36154.1), Kluyveromyces lactis (AY239586.1), Penicillium chrysogenum (XP_002562026.1), Pichia pastoris (FR839631.1 ; region 362551-364041), Pichia stipites (XP_001383282.2), Saccharomyces cerevisiae (NP_013824), Schizosaccharomyces pombe (CAC05245.1), Yarrowia lipolytica (Q6C7B9)

Supplementary Fig. 1

1