Dong et al, Supplementary Information
Supplementary Materials and Methods
Cell proliferation and differentiation assays
After trypsinizing neurospheres, single cell suspensions were prepared in DMEM/F12 medium containing EGF and bFGF, and were seeded into 96-well plates (Corning Incorporated, USA) at a density of 103 cells per ml. After 7-days, colonies of a diameter >30 μm were scored.
For differentiation, 1×105 cells of single cell suspensions were plated in 24-well plates coated by polyornithine/laminin (Sigma). Cells were cultured overnight in proliferation medium before differentiation medium (DMEM/F12, 2% B27, 1% penicillin-streptomycin, 1% FBS) was applied. The medium was replaced every other day and after 4-7 days of induction and cells were fixed in 4% paraformaldehyde for 15 min before immunocytochemistry.
Cell cycle analysis
At indicated time points post HU treatment, cells were harvested, fixed, permeabilized in 70% ice-cold ethanol for 12 h and treated with 100μg/ml RNase A at 37°C for 30 min. DNA content was determined by FACS Calibur flow cytometer (BD Biosciences) with PI (Sigma) staining and cell cycle distribution was analyzed with ModFit software (Verity Software House Inc, Topsham, USA).
Reactive oxygen species measurement.
To measure intracellular ROS, we loaded cells with 10 μM DHE (Invitrogen) and analyzed the intracellular fluorescence intensity by using a Spectramax spectrophotometer. Experiments were performed in triplicates from three independent trials with results presented as the mean±SE.
Immunocytochemistry
Cells grown on coverslips were fixed in 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.3% Triton X-100 in PBS for 10 min, and blocked in 3% normal donkey serum in PBS for 2 h at room temperature. Primary antibodies were diluted in 3% normal donkey serum in PBS and applied at 4°C overnight. The primary antibodies used in these experiments were as follow: γ-H2AX (Abcam; 1:1,000), Nestin (Abcam; 1:3000), GFAP (millpore; 1:3000), Tuj1 (covance; 1:10000), Sox2 (Santa Cruz;1:500) , After rinsing in PBS three times and incubating for 2h with CF488 and CF543 (Biotium; 1:1000), coverslips were washed three times, cell nuclei were stained with DAPI. Images were acquired on a Leica TCS SP2 confocal fluorescence microscope.
Semi- and Quantitative RT-PCR.
For semi-quantitative RT-PCR, total RNA was isolated using TRIzol reagent (Invitrogen) and the first strand cDNA was synthesized using RevertAidTM First Stand cDNA Synthesis Kit (Fermentas, Burlington, Canada). PCR amplification was performed using the Taq DNA Polymerase system (Fermentas). The primers used are as follows:
PRDX1 For: 5'-TGTCCCACGGAGATCATTGC-3',
PRDX1 Rev: 5'-CACAGAAGCGCCAATCACTT-3';
SOD2 For: 5'-CAGACCTGCCTTACGACTATGG-3',
SOD2 Rev: 5'-CTCGGTGGCGTTGAGATTGTT-3';
GAPDH For: 5'-GGTGAAGGTCGGTGTGAACG-3',
GAPDH Rev:5'-CTCGCTCCTGGAAGATGGTG-3'.
For QRT-PCR, total RNA was reverse-transcribed using SuperScript III (Invitrogen). All reactions were performed using SYBR® Green PCR Core reagents (Applied Biosystems). Primers were designed using Primer Express software (Applied Biosystems) and experimentally validated. the sequences for primers used are as follows:
Gene / QRT-PCR forward primer / QRT-PCR reverse primerKu70 / CTCCCTTATGCCGATGACA / ACCACTTGCTCCGACTCCA
p21 / TACTTCCTCTGCCCTGCTGC / GCTGGTCTGCCTCCGTTTT
Xrcc2 / ATGTGTAGCGACTTTCGCAGA / CATCAGCAAACAGGTTGGGTT
Xrcc4 / CCTTGGAGGCTGATTTGTA / ACTTTCTTCATCGGTGCTT
P16 / GGGTTTCGCCCAACGCCCCGA / TGCAGCACCACCAGCGTGTCC
P53 / TTCAGGCTTATGGAAACTAC / AGAAGGGACAAAAGATGACA
Brca1 / CGAATCTGAGTCCCCTAAAGAGC / AAGCAACTTGACCTTGGGGTA
Ligase4 / CTTAAAGCTTGGCATCAGTCAG / AACCGTTTCTGGAGAAGTACCGAT
PRDX1 / TGTCCCACGGAGATCATTGC / CACAGAAGCGCCAATCACTT
SOD2 / CAGACCTGCCTTACGACTATGG / CTCGGTGGCGTTGAGATTGTT
GAPDH / GGTGAAGGTCGGTGTGAACG / CTCGCTCCTGGAAGATGGTG
The expression of each gene was defined from the threshold cycle (Ct), and relative expression levels were calculated by using the △△CT method after normalization with reference to expression of the housekeeping gene GAPDH. Results are means from three individual experiments.
Western blot analysis
Cultured NSCs were washed with ice-cold PBS, lysed with 2×SDS lysis buffer. Protein concentrations were measured by the BCA protein assay kit (Pierce). Proteins were separated on 8% SDS-polyacrylamide gels (Bio-rad) and transferred to a PVDF membrane (Millipore). Membranes were blocked in 5% non-fat milk powder in TBS-T (0.1% Tween-20 in TBS), and incubated with primary antibody overnight at 4 ℃. After washed with tris buffered saline TBS-T, the membranes were incubated with HRP conjugated secondary antibodies (Invitrogen) for 1 h at room temperature. After washed with TBS-T three times, the membranes were detected using ECL Super Signal (Pierce, Rockford, IL, USA), and bands were quantitated with ImageQuant. Primary antibodies were mouse anti-βactin (Sigma), rabbit anti-p16 (Abcam), rabbit anti-p21 (Abcam), rabbit anti-ku70 (Abcam), rabbit anti-Xrcc2 (ABclonal), rabbit anti-Xrcc3 (ABclonal), rabbit anti-Xrcc4 (ABclonal).
Protein separation by 1D SDS-PAGE and proteomics analysis
Equal amount of proteins from untreated- and treated-samples (about 60 µg) were separated by 1D SDS-PAGE, respectively. The gel bands of interest were excised from the gel, reduced with 25 mM of DTT and alkylated with 55 mM iodoacetamide. In gel digestion was then carried out with sequencing grade modified trypsin in 50 mM disodium hydrogen phosphate at 37ºC overnight. The peptides were extracted twice with 0.1% trifluoroacetic acid in 50% acetonitrile aqueous solution for 30 min. Extracts were then centrifuged in a speedvac to reduce the volume.
Peptides from different samples were labeled with tandem mass tags (TMT) reagents (Thermo, Pierce Biotechnology) according to the manufacturer’s instruction. Briefly, the TMT label reagents were dissolved by anhydrous acetonitrile and carefully added to each digestion products. The reaction was performed for 1 h at room temperature, and hydroxylamine was used to quench the reaction. The TMT-labeled peptides were desalted using the stage tips.
For LC-MS/MS analysis, the digestion product was separated by a 65 min gradient elution at a flow rate 0.250 ml/min with an EASY-nLCIITM integrated nano-HPLC system (Proxeon, Denmark) which was directly interfaced with a Thermo Orbitrap Q Executive mass spectrometer. The analytical column was a homemade fused silica capillary column (75 mm ID, 150 mm length; Upchurch, Oak Harbor, WA) packed with C-18 resin (300 Å , 5 mm, Varian, Lexington, MA). Mobile phase A consisted of 0.1% formic acid, and mobile phase B consisted of 100% acetonitrile and 0.1% formic acid. The Q Exactive mass spectrometer was operated in the data-dependent acquisition mode using Xcalibur 2.1.2 software and there was a single full-scan mass spectrum in the orbitrap (400-1800 m/z, 60,000 resolution) followed by 10 data-dependent MS/MS scans at 27% normalized collision energy (HCD). The MS/MS spectra from each LC-MS/MS run were searched against the selected database using an in house Proteome Discoverer searching algorithm.
The MS/MS spectra from each LC-MS/MS run were searched against the selected database (IPI human v3.84) using an in-house Proteome Discoverer 1.3 software (Thermo, USA). The search criteria were as follows: full tryptic specificity was required; one missed cleavage was allowed; carbamidomethylation (C) and TMT sixplex (K and N-terminal) were set as the fixed modifications; the oxidation (M) was set as the variable modification; precursor ion mass tolerances were set at 10 ppm for all MS acquired in an orbitrap mass analyzer; and the fragment ion mass tolerance was set at 20 mmu for all MS2 spectra acquired. Relative protein quantification was also performed using Proteome Discoverer software (version 1.3) according to manufacturer’s instructions on the six reporter ion intensities per peptide. Quantitative precision was expressed as protein ratio variability. Differentially expressed proteins were further confirmed by QRT-PCR or western blotting.
Supplementary Table S1
Statistics for Figure 1C0.5mM HU 1h vs 0.5mM HU 12h
Row Factor / Difference / t / P value / Summary
Ctrl / -0.6667 / 0.1341 / P > 0.05 / ns
0 hr / 9.667 / 1.945 / P > 0.05 / ns
1 hr / 9.333 / 1.878 / P > 0.05 / ns
12 hr / 2 / 0.4024 / P > 0.05 / ns
36 hr / 4 / 0.8048 / P > 0.05 / ns
0.5mM HU 1h vs 8mM HU 1h
Row Factor / Difference / t / P value / Summary
Ctrl / 0 / 0 / P > 0.05 / ns
0 hr / 7.667 / 1.543 / P > 0.05 / ns
1 hr / 7 / 1.408 / P > 0.05 / ns
12 hr / 3.667 / 0.7377 / P > 0.05 / ns
36 hr / 5.333 / 1.073 / P > 0.05 / ns
0.5mM HU 1h vs 8mM HU 12h
Row Factor / Difference / t / P value / Summary
Ctrl / 0.3333 / 0.06707 / P > 0.05 / ns
0 hr / 22.33 / 4.493 / P<0.001 / ***
1 hr / 31 / 6.237 / P<0.001 / ***
12 hr / 63.67 / 12.81 / P<0.001 / ***
36 hr / 73 / 14.69 / P<0.001 / ***
0.5mM HU 12h vs 8mM HU 1h
Row Factor / Difference / t / P value / Summary
Ctrl / 0.6667 / 0.1341 / P > 0.05 / ns
0 hr / -2 / 0.4024 / P > 0.05 / ns
1 hr / -2.333 / 0.4695 / P > 0.05 / ns
12 hr / 1.667 / 0.3353 / P > 0.05 / ns
36 hr / 1.333 / 0.2683 / P > 0.05 / ns
0.5mM HU 12h vs 8mM HU 12h
Row Factor / Difference / t / P value / Summary
Ctrl / 1 / 0.2012 / P > 0.05 / ns
0 hr / 12.67 / 2.548 / P > 0.05 / ns
1 hr / 21.67 / 4.359 / P<0.001 / ***
12 hr / 61.67 / 12.41 / P<0.001 / ***
36 hr / 69 / 13.88 / P<0.001 / ***
8mM HU 1h vs 8mM HU 12h
Row Factor / Difference / t / P value / Summary
Ctrl / 0.3333 / 0.06707 / P > 0.05 / ns
0 hr / 14.67 / 2.951 / P < 0.05 / *
1 hr / 24 / 4.829 / P<0.001 / ***
12 hr / 60 / 12.07 / P<0.001 / ***
36 hr / 67.67 / 13.61 / P<0.001 / ***
Supplementary Table S2
Gene Symbol / Description / Location / Family / HU/Con / Log Ratiosuclg2 / succinate-CoA ligase, GDP-forming, beta subunit / Cytoplasm / enzyme / 2.453 / 1.294547234
SNRPB2 / small nuclear ribonucleoprotein polypeptide B / Nucleus / other / 5.336 / 2.415758667
Mrpl3 / mitochondrial ribosomal protein L3 / Cytoplasm / other / 2.306 / 1.205392513
Krt16 / keratin 16 / Cytoplasm / other / 2.035 / 1.025028794
IDH3B / isocitrate dehydrogenase 3 (NAD+) beta / Cytoplasm / enzyme / 2.027 / 1.019346089
hnrpll, GPX4 / heterogeneous nuclear ribonucleoprotein L-like / unknown / other / 2.449 / 1.292192774
HNRPDL / heterogeneous nuclear ribonucleoprotein D-like / Nucleus / other / 2.057 / 1.040541794
h2afy2 / H2A histone family, member Y2 / Nucleus / other / 2.286 / 1.192825404
H2AFY / H2A histone family, member Y / Nucleus / other / 2.236 / 1.160920188
GNAO1 / guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O / Plasma Membrane / enzyme / 2.565 / 1.358958826
Gm8767, ALDOA / aldolase A, fructose-bisphosphate / Cytoplasm / enzyme / 2.275 / 1.185866545
gm2a / GM2 ganglioside activator / Cytoplasm / enzyme / 0.364 / -1.457989644
Gbas / glioblastoma amplified sequence / Plasma Membrane / other / 0.49 / -1.029146346
CTSC / cathepsin C / Cytoplasm / peptidase / 0.435 / -1.200912694
Ccdc51 / coiled-coil domain containing 51 / Cytoplasm / other / 2.087 / 1.0614306
ACSF2 / acyl-CoA synthetase family member 2 / Cytoplasm / enzyme / 2.239 / 1.162854528
ACADM / acyl-CoA dehydrogenase, C-4 to C-12 straight chain / Cytoplasm / enzyme / 2.044 / 1.031395196
acadl / acyl-CoA dehydrogenase, long chain / Cytoplasm / enzyme / 2.676 / 1.420078116
2410091C18Rik / chromosome 2 open reading frame 56 / Cytoplasm / other / 2.587 / 1.371280054
Uqcrc2 / ubiquinol-cytochrome c reductase core protein II / Cytoplasm / enzyme / 2.129 / 1.09017595
SUCLA2 / succinate-CoA ligase, ADP-forming, beta subunit / Cytoplasm / enzyme / 3.043 / 1.605494334
Slc25a25 / solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 / Cytoplasm / transporter / 2.557 / 1.354452161
SLC25A22 / solute carrier family 25 (mitochondrial carrier: glutamate), member 22 / Cytoplasm / transporter / 2.167 / 1.115699153
Rps5 / ribosomal protein S5 / Cytoplasm / other / 0.272 / -1.878321443
RPS28 / ribosomal protein S28 / Cytoplasm / other / 2.002 / 1.001441974
rpl19 / ribosomal protein L19 / Cytoplasm / other / 0.465 / -1.104697379
RALY / RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse)) / Nucleus / other / 2.443 / 1.288653864
psmb2 / proteasome (prosome, macropain) subunit, beta type, 2 / Cytoplasm / peptidase / 0.43 / -1.217591435
PLOD1 / procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 / Cytoplasm / enzyme / 0.463 / -1.110915901
PECI / enoyl-CoA delta isomerase 2 / Cytoplasm / enzyme / 2.577 / 1.365692537
MRPS27 / mitochondrial ribosomal protein S27 / Cytoplasm / other / 2.26 / 1.176322773
mrps17 / mitochondrial ribosomal protein S17 / Cytoplasm / other / 2.122 / 1.085424656
LOC100047577 / cytochrome b5 type B (outer mitochondrial membrane) / Cytoplasm / enzyme / 0.47 / -1.089267338
ldhb , Gm5514 / lactate dehydrogenase B / Cytoplasm / enzyme / 2.208 / 1.142740172
L2HGDH / L-2-hydroxyglutarate dehydrogenase / Cytoplasm / enzyme / 2.117 / 1.082021269
IDI1 / isopentenyl-diphosphate delta isomerase 1 / Cytoplasm / enzyme / 0.457 / -1.12973393
HIBCH / 3-hydroxyisobutyryl-CoA hydrolase / Cytoplasm / enzyme / 2.494 / 1.318461465
Got2 / glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) / Cytoplasm / enzyme / 2.248 / 1.168642036
Gm5191, BZW1 / basic leucine zipper and W2 domains 1 / Cytoplasm / translation regulator / 2.016 / 1.011495639
FECH / ferrochelatase / Cytoplasm / enzyme / 2.342 / 1.227741076
Erlin2 / ER lipid raft associated 2 / Plasma Membrane / other / 2.179 / 1.123666196
COX6C / cytochrome c oxidase subunit VIc / Cytoplasm / enzyme / 2.378 / 1.249748715
COX2 / cytochrome c oxidase subunit II / Cytoplasm / enzyme / 0.258 / -1.954557029
atp6v0d1 / ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1 / Cytoplasm / transporter / 2.478 / 1.309176187
ATP5E / ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit / Cytoplasm / transporter / 3.015 / 1.592158002
prpf38a / PRP38 pre-mRNA processing factor 38 (yeast) domain containing A / Nucleus / other / 2.201 / 1.138159145
Idh3g / isocitrate dehydrogenase 3 (NAD+) gamma / Cytoplasm / enzyme / 2.187 / 1.12895322
emd / emerin / Nucleus / other / 2.013 / 1.009347172
DECR1 / 2,4-dienoyl CoA reductase 1, mitochondrial / Cytoplasm / enzyme / 2.461 / 1.299244658
BAX / BCL2-associated X protein / Cytoplasm / transporter / 0.302 / -1.727379545
NDUFB9 / NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa / Cytoplasm / enzyme / 0.34 / -1.556393349
NDUFB10 / NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10, 22kDa / Cytoplasm / enzyme / 0.333 / -1.586405918
NDUFAF2 / NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 2 / Cytoplasm / other / 0.453 / -1.142417045
Sod2 / superoxide dismutase 2, mitochondrial / Cytoplasm / enzyme / 0.47 / -1.089267338
Ndufa4 / NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa / Cytoplasm / enzyme / 2.655 / 1.408711861
PTK2 / PTK2 protein tyrosine kinase 2 / Cytoplasm / kinase / 2.226 / 1.154453593
PRDX1 / peroxiredoxin 1 / Cytoplasm / enzyme / 0.484 / -1.046921047
ddx56 / DEAD (Asp-Glu-Ala-Asp) box helicase 56 / Nucleus / enzyme / 0.435 / -1.200912694
Atp5k / ATP synthase, H+ transporting, mitochondrial Fo complex, subunit E / Cytoplasm / transporter / 2.279 / 1.188400925
Atp5a1 / ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1 / Cytoplasm / transporter / 0.461 / -1.117161344
ACAT1 / acetyl-CoA acetyltransferase 1 / Cytoplasm / enzyme / 3.174 / 1.666302128
ACAA2 / acetyl-CoA acyltransferase 2 / Cytoplasm / enzyme / 2.072 / 1.051024003
PSMD13 / proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 / Cytoplasm / peptidase / 2.057 / 1.040541794
LdhA / lactate dehydrogenase A / Cytoplasm / enzyme / 2.132 / 1.092207438
Tial1 / TIA1 cytotoxic granule-associated RNA binding protein-like 1 / Nucleus / transcription regulator / 2.031 / 1.02219024
MRPS34 / mitochondrial ribosomal protein S34 / Cytoplasm / other / 0.49 / -1.029146346
Supplementary Figure Legends: