Supplementary Figure 1: Transcription of Autophagy Genes Is Not Induced by OHT

Supplemental data

Supplementary Figure 1: Transcription of autophagy genes is not induced by OHT.

Parental U2OS cells were treated with OHT (300nM) for the indicated times (in hours). Total RNA was extracted and RT-PCR performed using primers specific for the ATG1, ATG5, LC3, DRAM and GAPDH genes.

Materials & Methods

RT-PCR. Reverse transcription-PCR (RT-PCR) was performed on total RNA prepared by the Tri Reagent method. 7.5 g of RNA was employed for cDNA synthesis using M-MLV reverse transcriptase (Promega) and oligo dT (Pharmacia). Indicated below are the sequences of 5’ and 3’ primers used for each of the tested genes, respectively.

For the gene encoding ATG1:

5’ TCATGGAGCAAGAGCACACG and 5’ACAGCTTGCACTTGGTGACG.

For the gene encoding ATG5:

5’ TTTTCACTGTGGTCCCTGGC and 5’ ATCCCCAAAATGAACCGACG.

For the gene encoding LC3:

5’ AGACCTTCAAGCAGCGCCG and 5’ ACACTGACAATTTCATCCCG.

For the gene encoding GAPDH:

5’ ACCACAGTCCATGCCATCAC and 5’ TCCACCACCCTGTTGCTGTA.

For the gene encoding DRAM:

5’ CCGCCTTCATTATCTCCTAC and 5’ CCCATTCCGAAACATCCCAC.

Retroviral infection. Cells of the packaging cell line 293T were co-transfected with 10 g of  ecotropic packaging plasmid, pSV--E-MLV, and 10 g of the relevant plasmid using the calcium phosphate method in the presence of chloroquin (25 M final concentration, Sigma C6628). After 8 hr, the transfection medium was replaced with fresh medium, and retroviral containing cell supernatant was collected at intervals. For infection, WI38 cells expressing ecotropic receptor were incubated for 5 hr with retroviral supernatant, supplemented with 8 g/ml of polybrene (Sigma H9268). 24 hr later, selection with 0.8 g/ml of puromycin (Sigma P7130) was performed.

Luciferase assay. U2OS cells were transfected using jetPEITM (PolyPlus-transfection) and luciferase assay was performed essentially as described (Lindeman et al., 1997).

Plasmids. DRAM-Luc plasmid: A human DRAM promoter (-867 to +111) fragment was amplified from U2OS genomic DNA, verified by sequencing and cloned into pA3-Luc to generate –867/+111 DRAM-luciferase.

pRS-E2F1: Short hairpin RNAs specific for human E2F1 (5’ GACGTGTCAGGACCTTCGT –pRS-E2F11) and (5' TTTGATTTGCTTCCTAACA–pRS-E2F12) were cloned into the retroviral pRETRO-SUPER vector.

Chromatin immunoprecipitation (ChIP). ChIP was performed with U2OS cells using ChIP assay kit (Upstate). Antibodies were used 2 g per immunoprecipitation: HA (Santa Cruz, sc-805), E2F1 (Santa Cruz, sc-193x) and E2F4 (Santa Cruz, sc-866).

Primers used for PCR were for ATG1 promoter (forward) 5’-CAGAGAAGAAGCGGGGCGG and (reverse) 5’-CCGGGCGTGACGAACAGA, for LC3 promoter (forward) 5’-TGGAGGGGAAAGGATGGTCG and (reverse) 5’-GGGGCGGAGCAGGTGTGTG, for DRAM promoter (forward) 5’-GCTGATCTCTAGTTCTTGGG and (reverse) 5’-ACACCCGAAAACCCAGACAG and for -actin (forward) 5’-ACTCTTCCAGCCTTCCTTCC and (reverse) 5’-TCCTTCTGCATCCTGTCAGC.

Fluorescence microscopy. U2OS cells were plated on coverslips and cultured under the conditions indicated. Cells were fixed with cold methanol for 5 min at -20oC and permeabilized with cold acetone. Cells were blocked by incubation with 10% FCS in PBS for 30 min and then incubated with primary antibody for 1.5 hours. Cells were then incubated with secondary antibody for 15 min.

Western blotting. Cells were lysed in lysis buffer [50mM Tris pH 7.5, 150mM NaCl, 1mM EDTA, 1% NP-40 and protease inhibitors]. Equal amounts of protein from each lysate, as determined by Bradford assay, were resolved by electrophoresis in a SDS 10% polyacrylamide gel and then transferred to a filter. Filter was incubated with -E2F-1 (sc-251, Santa-Cruz), -LC3 (gift of Prof. Zvulun Elazar), -ATG5 (A0731, Sigma) and tubulin (T9026, Sigma). Binding of the primary antibody was detected using an enhanced chemiluminescence kit (ECL Amersham).

Lindeman GJ, Gaubatz S, Livingston DM and Ginsberg D. (1997). Proc. Natl. Acad. Sci. USA, 94, 5095-100.