Supplemental Material + Legends of Figures

Supplemental Material + Legends of Figures

Supplemental Material

General molecular methods

DH5α Escherichia coli strain was used for all transformations. Plasmid extractions from E. coli were purified by the PEG method. Alternatively, plasmids were prepared with NucleoBond kits (Macherey-Nagel, Düren, Germany). Amplification fragments were purified from PCR reactions with the Illustra GFX PCR DNA and Gel Bands Purification Kit (GE Healthcare Life Sciences, Little Chalfont, UK).

Deletion of the ASY2/MER2 and ASY3/REC114 genes

Null asy2/mer2 and asy3/rec114 mutants were generated by single step gene replacement with a hygromycin resistance cassette replacing the entire ORF from ATG to the stop codon. Transformants were selected for hygromycin resistance and the presence of the deleted allele was confirmed by DNA sequencing. Transformations were performed in a ku70D mutant background, which increases the homologous integration events. In order to eliminate the ku70D allele, asy2/mer2D and asy3/rec114D were subsequently introduced in a KU70 WT background by genetic crosses. Introduction of an ectopic WT ASY2/MER2 or ASY3/REC114 gene in the null mutants, restored a wild-type phenotype in both cases.

WT Asy2/Mer2-GFP fusion

GFP (p-EGFP-1; Clontech) coding sequence was fused to the C-terminus of ASY2/MER2 under the control of the ASY2/MER2 promoter. A fragment of 2410 bp containing the entire open reading frame of ASY2/MER2, 1562 bp and 848 bp of the 5’ flanking sequence respectively was amplified using the two primers 5’- cgagtttactcctggccaaaaa -3’ and 5’- cgcggatcccacctcagcaagcgccgtc -3’. This latter primer replaces the stop codon of ASY2 CDS by a BamHI site (underlined nucleotides in the primers). This fragment was cloned in a pJET1.2 vector using CloneJET PCR Cloning Kit (ThermoFisher). The corresponding pJet-ASY2 plasmid was linearized by BamHI XbaI (XbaI site is after BamHI site in the MCS of the pJET1.2 vector) and was ligated in frame with the XbaI-BamHI fragment containing the GFP (p-EGFP-1) to obtain pJet-ASY2-GFP plasmids. After validation by sequencing, the GFP allele was ectopically integrated into a WT strain. After selection for hygromycin resistance, transformants were screened for the expression of the Asy2-GFP fusion protein. The GFP-tag does not affect the normal function of Asy2 because Asy2-GFP in WT or in asy2/mer2D is wild type by all criteria and thus fully functional.

Construction of Asy2-GFP mutant alleles

The same strategy was used for pJet-Asy2-2-GFP, except that the 3’ primer had to be changed because in asy2-2, the mutation changes the CAA codon in position 450 into a stop codon giving a shorter CDS. Thus, a fragment of 2248 bp containing the entire open reading frame of ASY2-2, 1400 bp and 848 bp of the 5’ flanking sequence, respectively, was amplified using the two primers 5’- cgagtttactcctggccaaaaa -3’ and 5’- cgcggatccgccgatgaacttccatatgaagag -3’. This latter primer replaces the stop codon of ASY2-2 CDS by a BamHI site (underlined nucleotides in the primers). The following steps were similar to those described for Asy2-GFP.

For pJet-Asy2-5-GFP and pJet-Asy2-17-GFP we used a SalI unique site of the pJet-Asy2-GFP located in asy-2 CDS upstream from the asy2-5 mutation. Asy2-5-GFP, and Asy2-17–GFP were obtained by replacing the SalI BamHI fragment of pJet-Asy2-GFP by the corresponding SalI BamHI fragment amplified from asy2-5 or asy2-17 genomic DNA respectively using the same primer as previously. asy2-19 and the four mutant alleles affecting putative SUMO sites (Fig. 2A) were obtained from pJet-Asy2-GFP by inverse PCR using overlapping primers with desired substitution in the center of primers. Similarly, the four del mutant alleles were produced by inverse PCR with back-to-back primer flanking the region to be deleted.

After validation by sequencing, the different mutant-GFP alleles were ectopically integrated into a WT strain. After selection for hygromycin resistance, transformants were screened for the expression of the GFP fusion proteins (3-5 independent transformants were tested to check putative effects of the integration site on the GFP expression). For each construction, strains were validated by genotyping of the corresponding mutation. To analyze the mutant-GFP phenotype, each mutant-GFP was further crossed by mer2D.

RT-qPCR experiments

Cultures for RNA preparations were performed on 90 mm Petri dishes containing M1 minimal medium and covered with a cellophane sheet (Focus Packaging & Design Ltd, Scunthorpe, UK). Cultures were inoculated with one wild-type implant in the middle of the petri dish. Dishes were placed at 25°C under constant light and were removed from the incubation room after one to nine days. At day 1 and 2, the vegetative mycelium was scraped from the cellophane sheets with a glass cover-slip. From day 3 to day 9, the sexual cycle starts and the corresponding perithecia (fruiting bodies) were harvested by scraping them with a scalpel blade. RNAs were extracted, quantified and checked for integrity on a gel. Total RNAs were reverse transcribed with SuperScript III (Lifes Technologies) according to manufacturer’s instructions with oligo d(T)20. In each primer pair (Table S1), at least one primer was designed against two consecutive exons. Primer pairs have been checked for specific detection of cDNA, i.e. they do not detect gDNA. A non-reverse-transcribed control was however systematically performed on a pool of biological replicates. Four biological replicates were performed for each day and each biological replicate was analyzed in technical duplicate. The average Cq for each gene in each biological replicate is shown in Table S2. Four reference genes (PDF2, TIP, UBC and CIT1) were selected in a set of eight housekeeping genes (Table S2) using geNorm. The average expression stability of these four genes is M = 0.542, indicating heterogeneous biological replicates, and V4/5 = 0.121. The computation of the average normalized relative quantities is shown in Table S2. Briefly, a normalization factor (NF) was computed from the four reference genes and used to obtain the normalized relative quantity of ASY2/MER2, SPO11 and REC114 cDNAs for each biological replicate. An average relative quantity and its standard deviation were computed for the four biological replicates for each day. A bilateral Student test for heteroscedastic samples was used to compare the four biological replicates obtained at day 1 with those of the other days (Table S2). The cut-off for significant p-value was set below 0.01. RT-qPCR experiments were MIQE compliants.

Two-hybrids experiments

The strain Y526 (MATa Δgal4 Δgal80 URA3::GAL1-lacZ ura3 his3 ade2 lys2 leu2 trp1) was used for all two-hybrids experiments. Synthetic complete (syc) medium was based on synthetic minimal medium, and amino-acids and bases (Ile, Val, Arg, His, Lys, Met, Phe, Thr, Tyr, adenine, uracil) each at 0.1 g /l but lacked leucine (syc-Leu) or tryptophane (syc-Try) or both amino-acids (syc-Leu-Try), according to the plasmids present in the yeast strain. Transformations were performed using the high efficiency method of Gietz and Schiestl (1989).

cDNA sequences were amplified from RT-PCR at day 2 or day 4 (see above section RT-qPCR experiments) with appropriate primers (Table S3) and Phusion (ThermoFisher Scientific, Waltham, USA) or Pfu (Promega, Madison, USA) according to manufacturer’s indication. Amplified fragments were cloned directly into pJET1.2 (ThermoFisher Scientific, Waltham, USA), or digested with FastDigest restriction enzymes (ThermoFisher Scientific, Waltham, USA) and ligated with plasmid pBC SK(+) (Agilent, Santa Clara, USA). After plasmid amplification in E. coli, all inserts were sequenced to check for the absence of adventitious mutations before further digestion and cloning into pGBT9 (accession number CVU07646) and pGAD424 (accession number CVU07647). Restriction sites were selected for fusing the coding sequence of the amplification fragment with GAL4 binding domain (pGBT9) or activating domain (pGAD424). Recombinant pGBT9 and pGAD424 plasmids were amplified in E. coli, checked for predicted structure and transformed in Y526 yeast strain.

Colony assay of B-galactosidase activity

Five independent yeast colonies for each transformation were deposited on syc medium containing raffinose and supplemented as required with tryptophane (0.1 g/l) or leucine (0.1 g/l). After 36 h, a top containing 0.5 % agarose, 0.5 M phosphate buffer pH 7, 0.1 % sodium dodecyl sulfate, 7% N-dimethyl formamide and 0.4 % X-gal was layed on colonies to reveal the beta-galactosidase activity and incubated for 8 h at 30°C. Yeast colonies containing the PCL1 plasmid, which encodes the full length Gal4p, served as positive control.

For dosage of beta-galactosidase activity, 5 ml of syc medium containing galactose (2%), ethanol (2%) and glycerol (2%), and supplemented if required with tryptophane (0.1 g/l) or leucine (0.1 g/l), were inoculated with a single yeast colony (five independent replicates per assay). After 36 h, the cells were pelleted, rinsed with 5 ml of water, resuspended in 250 microliters of Z buffer (Platt et al., 1972), and disrupted in a FastPrep (MP Biomedicals, Santa Ana, USA) with glass beads and in the presence of PMSF (12,5 microliters of a 1mM solution). The lysate is recovered in 250 microliters of Z buffer and centrifuged twice at 4°C. Total proteins are quantified with a Bradford assay. The beta-galactosidase activity was determined on 100 microliters of extract mixed with Z buffer (900 microliters) and ONPG (200 microliters of a solution at 4 mg/ml in Z buffer). When a visible yellow color appeared, Na2CO3 was added (500µL of 1M) and the elapsed time since addition of ONPG was noted. The number of nanomole of cleaved ONP was quantified at 420 nm and the specific activity (SA) of the β-galactosidase was obtained from the following formula: SA = (OD420*1.7)/(0.0045*p*v*t); SA = specific activity in nanomole of cleaved ONPG per mg of protein and per min; p = protein concentration in mg/ ml; v= volume of assay (here v = 0.1 ml); t = elapsed time (in min) of incubation. A test of Student was performed on each series of assays to determine whether they are significantly different from the background signal obtained on extract from colonies transformed with one recombinant and one non-recombinant two hybrid vectors (Table S4). The possible interaction of the Mer2-C-terminus [designated as: Mer2C (287-504)] and Rec114 was tested by combining: pGADRec114 + pGBTMer2C (287-504) - pGADMer2C (287-504) + pGBTRec114. Interaction was detected by colony staining with X-Gal (five replicates for each assay). The colonies remained as white as the controls. Therefore no interaction between Rec114 and the Mer2-C terminus was detected by this assay and the beta-gal activity was not further tested by ONPG dosage.

Legends of Supplemental Figures

Figure S1A and S1B. Structural conservation among fungal (A), animal and plant (B) Mer2 family members

The conserved sequence signature motifs (SSM) #1 and #2 are framed in blue and red, respectively. Strictly conserved amino-acid residues are in white on a red background whereas partially conserved positions (Risler homology matrix, global score of 0.5) are in bold within yellow boxes. The position of the conserved coiled-coil domain is indicated right. The N-ter repeat motif is indicated by red lines in Fig. S1A. Species abbreviations: Smac, Sordaria macrospora; Ncra, Neurospora crassa; Ccin, Coprinopsis cinerea; Lbic, Laccaria bicolor; Afug, Aspergillus fumigatus; Anid, Aspergillus nidulans; Scer, Saccharomyces cerevisiae; Vpol, Vanderwaltozyma polyspora; Mmus, Mus musculus; Ggal, Gallus gallus; Nvec, Nemastostella vectensis; Zmay, Zea mays; Osat, Oryza sativa; Atha, Arabidopsis thaliana.

Figure S2. Maximum likelihood phylogenetic tree of Mer2 family members

Bootstraps values (200 replicates) are indicated for each node. Species abbreviations: Smac, Sordaria macrospora (Asy2); Ncra, Neurospora crassa; Ccin, Coprinopsis cinerea (Bad42); Anid, Aspergillus nidulans; Spom, Schizosaccharomyces pombe (Rec15); Scer, Saccharomyces cerevisiae (Mer2); Vpol, Vanderwaltozyma polyspora; Mmus, Mus musculus (IHO1); Ggal, Gallus gallus; Nvec, Nemastostella vectensis; Zmay, Zea mays; Osat, Oryza sativa (PAIR1); Atha, Arabidopsis thaliana (PRD3).

Figure S3. Mer2 localization WT, Rec8-GFP localization in mer2D and early-mid prophase nuclei of mer2-del2, mer2-19 and mer2-17.

(A,B) Prekaryogamy (the two haploid nuclei face each other) corresponds to Sordaria premeiotic S-phase. Mer2-GFP is seen as a diffuse signal in the two haploid nuclei (A). (B) Corresponding DAPI.

(C–E) Two late pachytene nuclei (C,E) where Mer2 foci become progressively more irregular in shape and appear as pairs of foci, one on each homolog now localized to chromatin loops, rather than to SC/axes (arrows in C). (D) Corresponding DAPI of (C).

(F,G) Rec8-GFP makes regular lines along all mer2D chromosomes, but the signal is always less smooth and bright than the Spo76-GFP signal (compare with Fig. 4E).

(H–J) One nucleus of mer2-del2 (H,I) and one of mer2-19 (J) with partial alignment and synapsis. The scattered segments of SC contain at least one E3 ligase Hei10 focus (arrows).

(K,L) Partial alignment in mer2-17. Alignment asynchrony is evident when the seven pairs are followed by their corresponding color code (e.g longest pair in red , shortest in blue).

Figure S4. Comparison of ascus sizes in WT and mutants for Rad51 loading and diplotenes.

(A–F) Early to mid leptotene in WT: Rad51-GFP appears early when asci are small (A,B) and remain visible during ascus elongation (C-F). They are fewer at zygotene (G,H).

(I–R) The same loading and disappearance of Rad51 foci is seen in mer2-19 (I–N) and mer2-17 (O–R) at similar ascus sizes.

(S–W) Number of Rad51 foci (in red) in mer2-19 (S–U) and mer2-17 (V,W). The numbers in red indicate the number of foci. (U,V) Corresponding DAPI.

(X–Z) Diplotenes of spo11D ski8Dand msh4D(DAPI). Note that chromosomes are highly condensed in all three mutants when compared to diplotenes of mer2D(Fig. 7E) and mer2-19 (Fig. 7I).

Bars, 2mm.

Figure S5. Comparison of CO interference between WT and mer2-17.

(A) The shape parameter (v) of gamma distribution is often used to describe the CO interference with a larger v indicating higher interference. For this purpose, the inter-adjacent-Hei10 foci distances in WT and mer2-17 were calculated (from 525 bivalents of mer2-17 and 658 bivalents of WT) as percentages of physical distances (micron). The best-fit gamma parameters for inter-Hei10 foci distances along all chromosomes were estimated by the maximum likelihood method with the "gamfit" function in MATLAB. Y axis = relative frequency; X axis = inter-focus distance of Hei10 foci in micron.

(B) CoC analysis indicates if the extent of COs in two intervals occurs independently or not. For each bivalent the positions of Hei10 foci was calculated as in (A). The dataset is then analyzed as follows. (1) Each bivalent is divided into a number of intervals of equal sizes (in this study, for each dataset three different number of intervals (10, 15 and 20) were tried and no obvious difference was seen). (2) On each bivalent, each CO is assigned to a specific interval. (3) In each interval, the frequency of bivalents with a CO is calculated. (4) In each pair of intervals, the frequency of bivalents with COs in both intervals ("observed" double COs) is estimated. (5) The frequency of "expected" double COs assuming COs occur independently in each interval is then calculated as the product of the observed frequencies of COs in the two individual intervals. (6) The coefficient of coincidence (CoC) is the quotient of observed/ expected double COs. (7) A CoC curve can be obtained when CoCs for all pairs of intervals are plotted as a function of the distances between the two intervals. For a typical CoC curve, at short inter-interval distances the CoC value is very low which indicates that CO interference is strong. And with increasing inter-interval distance the CoC value increases and eventually CoC values fluctuate around one, which indicates there is no interference at this distance. The inter-interval distance at CoC = 0.5 was used as a reliable and convenient indicator for CO interference strength (de Muyt et al, 2014).