Sirnas, Plasmids, and Transfection

Supplementary Methods

siRNAs and plasmids

Synthesized small interfering RNA (siRNA) duplexes were obtained from Invitrogen (Carlsbad, CA). The sequences of CAML siRNAs correspond to nucleotides (the coding region) 575 to 593 and 1295 to 1313. cDNAs of CAML (NM_001745) and PRLR (NM_000949) were cloned by RT-PCR using Pfu DNA polymerase, and inserted into pcDNA-HA or into pcDNA expression vector by blunt-end ligation. Cyclin D1 promoter (-698 to -1 from the translation site) DNA was amplified from the cyclin D1 gene (NCBI accession # Z29078) by PCR using Pfu polymerase. The PCR product obtained was inserted into basic pGL-3 luciferase plasmid (Promega Corp., Madison, WI) by blunt-end ligation.

Reporter assays

T47D cells were co-transfected with luciferase reporter plasmid and CMV--gal plasmid using Lipofectamine 2000. Transfected cells were allowed to stabilize for 48 h before being used in experiments. Luciferase activity was analyzed using a Lumat LB960 luminometer (Berthold Technologies, Bad Wildbad, Germany), and -gal assayswere performed to normalize transfection efficiencies.

Semiquantitative RT-PCR

Total RNAs were isolated from using TRIZOL (Invitrogen) from cultured T47D cells. Total RNA (1 g) was reverse-transcribed and the cDNA obtained was amplified over 18 to 20 PCR cycles in a reaction mixture containing 5 Ci [-32P]dCTP. PCR products were electrophoresed in a 4% polyacrylamide gel, and dried gels were autoradiographed. The forward and reverse nucleotide sequences of the primer pairs (5’ to 3’) for human CISH, cyclin D1, and -actin were ATCCAGGATTGCCTTGGTTC and AGCCTCTGTTTCTGGGAGGA; CCAGAAATGCACAGACCCAG and ATGAAGCCAGCTCACAGTGC; AAGAGAGGCATCCTCACCCT and ATCTCTTGCTCGAAGTCCAG, respectively.

Intracellular Ca2+ measurements

Intracellular Ca2+ concentrations were determined using Fluo-4 AM (Invitrogen) as a calcium indicator. T47D cells were plated in 96-well plates and loaded with 2 M Fluo-4 AM at 37℃ for 30 min. Plates were then washed three times with Hank’s basal saline solution containing 20 mM HEPES (pH 7.4), 1 mM Ca2+, and 1 mM Mg2+. Fluorescence was measured using a spectrofluorometer (F-MAX-0200-1300, Molecular Devices, CA) at excitation and emission wavelengths of 485 and 535 nm, respectively.

Immunofluorescence Staining

T47D cells were fixed with 3.7 % paraformaldehyde in phosphate buffered saline (PBS) at room temperature for 15 min, and permeabilized in 0.1 % Triton X-100. After blocking nonspecific binding with 5 % bovine serum albumin for 1 h, cells were incubated with anti-CAML (1:100) and anti-PRLR (1:100) at 4℃ overnight. Immune complexes were stained by incubating cells with FITC or Rhodamine-conjugated secondary antibodies (Invitrogen / Molecular Probe) at room temperature for 1 h. Nuclei were counterstained with DAPI (Sigma). After a final wash with PBS, coverslips were mounted using FluorSave Reagent (Calbiochem) and fluorescence was observed under a Zeiss LSM 510 laser scanning microscope.

Preparations of cytoplasmic and nuclear fractions

After a brief spin down, cells were resuspended using a lysis buffer consisting of 10 mM Tris, pH 7.8, 10 mM KCl, 0.1 mM EDTA, 1.5 mM MgCl2, and 0.2% NonidetP-40, 0.5 mM dithiothreitol, 1 mM Sodium orthovanadate and 0.4 mM PMSF.Cells were then pelleted at 1,000g for 5 min at 4℃, and supernatantswere saved to obtain the cytoplasmic fractions. One packed volume of extract buffer, consisting of 20 mM Tris (pH7.8), 420 mM NaCl, 0.1 mM EDTA, 1.5 mM MgCl2, 20% glycerol, 0.5 mM dithiothreitol, 1 mM sodium orthovanadate, and 0.4 mM PMSF, was added to nuclei and vortexed gently for 10 x 5 sec. Sampleswere then centrifuged at 20,000g for 5 minat 4℃, and supernatants(nuclear fractions) were saved. These fractions were frozen quickly in liquid nitrogen and stored at -70℃.

Preparations of cytoplasmic and nuclear fractions

After a brief spin down, cells were resuspended using a lysis buffer consisting of 10 mM Tris, pH 7.8, 10 mM KCl, 0.1 mM EDTA, 1.5 mM MgCl2, and 0.2% NonidetP-40, 0.5 mM dithiothreitol, 1 mM Sodium orthovanadate and 0.4 mM PMSF.Cells were then pelleted at 1,000g for 5 min at 4℃, and supernatantswere saved to obtain the cytoplasmic fractions. One packed volume of extract buffer, consisting of 20 mM Tris (pH7.8), 420 mM NaCl, 0.1 mM EDTA, 1.5 mM MgCl2, 20% glycerol, 0.5 mM dithiothreitol, 1 mM sodium orthovanadate, and 0.4 mM PMSF, was added to nuclei and vortexed gently for 10 x 5 sec. Sampleswere then centrifuged at 20,000g for 5 minat 4℃, and supernatants(nuclear fractions) were saved. These fractions were frozen quickly in liquid nitrogen and stored at -70℃.

Isolation of cell surface proteins

T47D cells were incubated with EZ-Link Sulfo-NHS-SS-Biotin reagent (Thermo Fisher Scientific Inc., Rockford, IL), andunbound biotin was removed by quenching and washing. For protein determinations, biotinylated cells were lysed and cellular debris was removed by centrifugation. Biotinylated surface proteins were then pulled down using avidin agarose beads and proteins were eluted by boiling in a denaturing SDS sample buffer.