Electronic Supplementary Material
MoS2 based digital response platform for aptamer based fluorescent detection of Pathogens
Pargat Singh12!· Ritika Gupta1! · Monika Sinha1· Rajesh Kumar2·Vijayender Bhalla1*
1CSIR-Institute of Microbial Technology, Chandigarh 160036, India
2UIET-Panjab University, Chandigarh-160014, India
!Both authors contributed equally
*Corresponding author, e-mail: , Phone: +91-172-6665235
Preparation of pathogenic strains
Strains of pathogens were taken from IMTECH, MTCCin a lyophilized form. It was mixed with few microliters of nutrient broth and spread on a nutrient agar plate. Colony was taken and again streaked on another plate. From the streaked plate single colony was picked up and inoculated in 100mLnutrient broth media and kept overnight at 37° C in incubator shaker. 0.1% of primary culture was inoculated in nutrient broth and kept overnight at 37° C in an incubatorshaker.Culture used for the experiment was of 1 O.D. (109CFU⋅mL-1) and further dilution was made using the same.
Apt-FAM probe sequence
The sequence of Apt-FAM probe is (5’-FAM-ATAGGAGTCACGACGACCAGAAA GTAATGCCCGGTAGTTATTCAAAGATGAGTAGGAAAAGATATGTGCGTCTACCTCTTGACTAAT-3 [1]. The Apt-FAM probe was reconstituted in double distilled water and stock was prepared. Further dilution was prepared in 1X PBS using the stock. Primer sequences are underlined in sequence
.
Concentration optimization of Apt-FAM probe
100 µl each of 109CFU·mL-1 S. typhimurium cells were coated on a poly-Lysine plate.Fig. S1 shows the binding assay between APT-FAM probe and cells immobilized on plate. The fluorescence intensity increases upon increasing the concentration of Apt-FAM probe. Fluorescence intensity at 50 nM concentration was found to be optimum as it gives sufficient fluorescence window for pathogen detection.
Fig. S1 Fluorescence binding assay of Apt-FAM probe with immobilizedS.typhimuriumcells on a microtiter plate.
Fluoroscence quenching kinetics
Fig. S2 Fluorescence intensity quenching kinetics of Apt-FAM probe with respect to time shows an exponential decrease in intensity within 5 minutes.
Opacity Effect of pathogens
In order to rule out any effect from opacity in our experiments results, we performed studies with different concentrations of S. typhimurium cells upon its incubation with the optimized concentration of Apt-FAM probe. Fig. S3 shows the fluorescence intensity of Apt-FAM probe when incubated with different concentrations of pathogens. Clearly there is no change in fluorescence as the concentration of pathogen changes thus any ruling out any issue of opacity in our experiments.
Fig. S3. Fluorescence intensity of Apt-FAM probe upon incubation with different concentration of S. typhimurium cells (CFU·mL-1) without the addition of MoS2-NS.
Extraction and Antibody generation
Crude Membrane protein (CMP) was extracted from the S.typhimurium cells using the ultracentrifugation method in which cells were first sonicated for 1h in 10mMTris-HCl (pH 7.4), followed by centrifugation at 9391 rcffor 15 min. The supernatant collected was further ultracentrifuged for 1 hour at 154005 rcfto obtain CMP in pellet. The CMP was solubilized at the concentration of 20mg⋅mL-1in Laemmali bufferwith addition of 150mMNaCl overnight at 37°C. Then, ultracentrifugation was performedfor 1 h at 154005 rcffollowed by dialysis in 10 mMTris-HCl (pH 7.4) with 100mMNaCl. Dialyzed sample was purified by akta purifier using gel filtration column, HiprepSuperdex S-100 16/60 pg. Purification buffer used was 10mM TrisHCl (pH 7.4), 150mM NaCl and 0.1%SDS was added to prevent aggregation of protein. The purified protein sample was used for immunization of New Zealand rabbits for the generation of polyclonal antibodies against CMP. For this, young (4–6 weeks old) New Zealand white rabbits were immunized subcutaneously with 210 µg of CMP emulsified with Freund’s complete adjuvant. Subsequently, four secondary boosters of the same dose (emulsified with FICA) were injected at intervals of 21 days. The rabbits were bled on the 5th day after each booster, and the antibody titer was determined by ELISA. All experiments were performed in compliance with the relevant laws and institutional animal usage guidelines by obtaining required approval. Immunoglobulin G (IgG) fractions were purified from the sera using a protein-A Sepharose column. The anti-CMP antibody showed good binding affinity with S.typhimuriumcells.
Interaction of MoS2-Ns with pathogen
Indirect Elisa using antibody specific for S.typhimurium was carried out to check the interaction of MoS2-Ns with cells. MoS2-Ns (18µg⋅mL-1) were incubated overnight on microtiter plate at 4°C followed by washing with PBS in 0.05% Tween (PBST). 100 µL of S.typhimuriumcellsat a concentration of 109CFU⋅mL-1diluted in PBS buffer was added to each of the well. The plate was incubated for 2 h at 37°C and washed three times with PBST. Blocking of the plate was performed with 10% skim milk in PBS for 2 h at 37°C. Antibody against S.typhimurium raised in rabbit was used at 1:1K to 1:128K dilution prepared in 0.01% PBSM and 100µL was added to each well and incubated for 2 h at 37°C. After washing steps, 100 µL of anti-rabbit HRP conjugated secondary antibody (1:20K) was added and incubated for 45 mins. After washing, 100µL substrate (TMB.H2O2) was added to each well and plate was kept in dark at 37°C for 10 mins. Finally, the reaction was stopped by addition of 50 µL of 2 N H2SO4and the absorbance was read at 450 nm.Graph clearly shows binding of MoS2-Ns with S. typhimurium cells.
Scheme S1. Schematic explanation of antibody generation and MoS2-Ns interaction experiments with S.typhimurium cells.
Fig. S4.S. typhimurium cells binding to MoS2 Ns coated plate shown in comparison withstandard poly-D- lysine coating.
Specificity assay of Apt-FAM probe
For specificity analysis, 100 µL of each of the different pathogenic strains at a concentration of 105CFU·mL-1were coated on a poly-D-Lysine coated black microtiter plate. Fig. S5 shows fluorescence binding studies of Apt-FAM probe with different pathogenic strains immobilized on a microtiter plate. The APT-FAM probe showsbinding only with S. typhimurium, thus the probe is specific only to S. typhimurium.
Fig.S5 Fluorescence intensity of Apt-FAM probe incubated with different pathogen coated onpoly-Lysine plate.
Tap water and Skim milk testing
Skim milk 3% was prepared in 1X-PBS and was then spiked up with target pathogens S. typhimurium(107CFU⋅mL‾¹). Normal tap water was taken from our lab tap and was then spiked up with same concentration of target pathogen
.
Fig. S6. Assayresponse tothe presence of S. typhimurium(107 CFU·mL-1) in skim milk and tap water samples. It clearly shows that the assay is capable of detecting bacteria in food and real time water samples.
References
[1]Duan N, Wu S, Chen X, Huang Y, Xia Y, Ma X, & Wang Z (2013) Selection and characterization of aptamers against Salmonella typhimurium using whole-bacterium systemic evolution of ligands by exponential enrichment (SELEX).Journal of agricultural and food chemistry,61:3229-3234.