Isolation and Identification of Microorganism by 16S Rrna Method

Supplementary Information

Isolation and Identification of microorganism by 16s rRNA method

The bacterial strain was isolated from a wastewater drain of a textile finishing industry, Ichalkaranji, India. Wastewater suspension was serially diluted from 10-1 to 10-10 and poured the diluted suspension on the nutrient agar plates. Microbial colonies that appeared on the agar medium were re-suspended into the flasks containing fresh nutrient broth amended with the amaranth azo dye. The dye was added at the concentrations of 10 to 100 mg/l. About 10 actively growing colonies were selected for further screening. The screening was done to find out the efficient bacterial strains capable of decolorizing the amaranth azo dye. The bacterial strain which has highest degradation potential was grown aerobically on nutrient agar. Single pure colonies were used for extraction of DNA by using the DNAzol method (Chomczynski et al.1997). For PCR amplification, 200 ng of the bacterial genomic DNA was used for 100 μl reactions. Following primers were used for PCR and DNA sequencing, Forward primer 20F 5’ATGTTGATCATGGCTCA3’ and reverse primer 1540R 5’AAGGAGGTGATCCAACCGCA 3’ generated a PCR product of approximately 1.5 kbp. Forward and reverse primers were derived from an exact nucleotide position of primer binding region within 16S ribosomal RNA gene and it is based on 16S rRNA gene of E. coli.

PCR was carried out with 400 µM of final dNTP mix, 40 picomoles of each primer with 1 U of taq polymerase enzyme. Following conditions were used for thermal cycling. Initial denaturation at 94 ºC for 3 min, followed by 30 cycles of denaturation at 94 ºC for 1 min, primer annealing at 49 ºC for 1 min and primer extension at 72 ºC for 2 min, with final extension at 72 ºC for 5 min. An approximately 1.5 kbp amplicon was observed in 1 % (w/v) agarose gel performed in Bio-Rad mini electrophoresis systems. Gel was documented in Bio-Rad gel doc XR system.

PCR product was sequenced by Sanger’s dideoxy chain termination method and subjected to electrophoresis by automated DNA Sequencer Applied Biosystems ABI 3100 genetic analyzer. After DNA sequencing, the nucleotide data was subjected to BLAST analysis. The phylogenetic tree was constructed by using a Neighbor-Joining (NJ) method in MEGA4.1 software. The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the taxa analyzed by 16S rRNA sequence. Based on 16S rRNA gene NCBI BLAST analysis, the isolated species is L. sphaericus, which is found to be 99 percent identical to Lysinibacillus sphaericus TMB5 GU129144 among the selected taxonomic group.

The sequence of the 16S rRNA gene of the strain Lysinibacillus sphaericus DL8 is available under the GenBank ID: HQ829965.

Supplementary Fig. 1

Supplementary Table 1 FTIR, 1H NMR data of enzymatic transformation reactions

Sr. No. / Reaction / FTIR (cm-1) / 1H NMR (300MHz,CDCl3)
/ 3440(NH2) / δ=4.81 (2H, broad, NH2), 3.48 (s, 1H,OH), 7.01-7.19( m, 1H),
1 / 1644(N-H def) / 7.26 - 7.27 (dd, 1H ), 7.28 - 7.29 (m, 1H), 8.11 - 8.15 (dd, 1H).
1353 (-C-N stre.)
3461(NH2) / δ=12.25(s,1H), 7.63 (d,2H),
3090–2550 (OH) / 6.56 (d,2H), 4.80(s,2H),
2 / 1351(-C-N stre.)
1720( C=O)
3 / 3424 (NH2 sym.) / δ=8.83 (s, 1H, OH), 4.85 (s, 2H, broad NH2),
3689.6(NH2 asym) / 6.78-5.94 (m, 4H, aromatic)
3875.4(–OH str.)
4 / 3400 ( NH2)
2744(CHO), / δ=3.98(s, 2H, Broad, NH2), 6.66 (d, 1H ), 7.40 (m, 1H ), 7.45 ( dd, 1H),
1658 (CO),1577, / 9.80 (d, 1H, CHO), 6.68 (m,1H)

Supplementary Table 2 Azoreductase activity with nitro compounds as a substrate

Sr. No / Nitro compounds / Azoreductase activity (U/mg protein)
1 / 2-nitrophenol / 48 ±2.05
2 / 4-nitrobenzoic acid / 41 ±1.02
3 / 3-nitrophenol / 49 ±1.52
4 / 2-nitro-benzaldehyde / 62 ±2.6

Supplementary Table 3 Comparison of kinetic constants of azoreductases from different bacterial strains

Substrate / Km
(µM) / Vmax (µM/min/mg) / Organism
Methyl Red / 11 / 29 / E. faecalis (Punj and John, 2008)
57 / 0.41 / S. aureus (Chen et al. 2005)
Amaranth / 100 / NA / P. aeruginosa
(Nachiyar and Rajakumar, 2005)
34 ±1.03 / 67 ± 1.25 / L. sphaericus (This study)
Navitan fast blue / 62.5 / 16.67 / P. aeruginosa
(Nachiyar and Rajakumar, 2005)
Orange II / 1.5 / 17.8 / Pseudomonas KF46
(Zimmermann et al. 1982)

NA- not available

16