Figure S1.High-Throughput Functional Screening for DAB2IP-Targeting Mirnas

SUPPLEMENTARY FIGURE LEGENDS

Figure S1.High-throughput functional screening for DAB2IP-targeting miRNAs

A) Venn Diagram showing the overlap between miRNAs identified by high-throughput screening (Functional) and miRNAs suggested by mirWalk, Target Scan, and mirSystem prediction programs. Six miRNAs that are not detected by prediction algorithms are listed.

B) Top scoring miRNA hits were tested for their activity on endogenous DAB2IP protein in multiple human cell lines. Cells were transfected with indicated miRNA mimics for 48 hours. DAB2IP siRNAs mix (siDAB2IP) was used as positive control. DAB2IP protein levels were measured by western blotting, with actin or HSP90 as loading controls.

C) Schematic representation of pre-miR-149. Predicted minimum free energy (MFE) structure of pre-miR-149 was designed using RNAfold software; the sequences of miR-149-5p and miR-149-3p are highlighted.

Figure S2. miR-149-5p and miR-149-3p share the potential to target DAB2IP, but have different effects on cell motility

A) miR-149-3p expression in cell lines.Endogenous levels of miR-149-3p were measured by RT-qPCR. Values are normalized to RNU6B RNA and compared to miR-149-3p expression levels in RWP1-E.

B) Transfection of miR-149-3p mimicincreases mature miR-149-3p cellular levels, and reduces DAB2IP mRNA and protein. PC3 cells were transfected with miR-149-3p mimics (3nM) or control siRNA. miR-149-3p, miR-149-5p or DAB2IP mRNA levels were measured by RT-qPCR. Values are normalized to RNU6B RNA or histone H3 and compared to siCtrl sample (mean ± SD; n=3; ***P<0,001; *P>0,05; ns= not significant). A representative Western blot shows DAB2IP protein downregulation.

C) miR-149-3p increases invasion and migration of breast (HBL100) and ovarian (SKOV-3) cancer cells. Cells were transfected as indicated. Invasion assay were performed 48 hours post transfection: cells were plated under low serum conditions and the lower chamber was filled with high serum medium. Graph summarizes migrated cells per area (mean ± SD; n=3; ***P<0,001; **P<0,01; *P>0,05). DAB2IP levels were checked by western blot.

D) A miR-149-3p-specific antisense sponge reduces miR-149-3p endogenous levels. PC3 cells were transduced with the sponge construct (TW3 S149-3p) or empty vector (TW3 empty); RT-qPCR was performed to evaluate miR-149-3p and miR-149-5p levels. Values are normalized to SNORD25 RNA and compared to TW3 empty sample (mean ± SD; n=3; **P<0,01; ns= not significant). Western blot assay confirms an increase of endogenous DAB2IP protein levels.

E) miR-149-3p, but not miR-149-5p, stimulates invasion and migration of cancer cells. PC3 cells were transfected as indicated for 48 hours. Invasion assays were performed using matrigel-coated transwell filters under low serum conditions; the lower chamber was filled with high serum medium (10% FBS). Graph summarizes invaded cells per area (mean ± SD; n=3; ***P<0,001; **P<0,01; ns=not significant). DAB2IP depletion was checked by western blot, with actin as loading control.

F) miR-149-3p, miR-149-5p expression or DAB2IP depletion have negligible effects on the proliferation rate of transfected PC3. Cells were transfected as indicated for 48 hours. DNA content was analyzed by flow cytometry after Propidium Iodide (PI) staining. Graphs summarize percent distribution of the cells in various phases of the cell cycle (mean of 3 independent experiments).

G) miR-149-3p, but not miR-149-5p, stimulates migration of normal cells. Non-transformed prostate cells were treated as in Figure 3D. Migration assays were performed under low serum conditions; the lower chamber was filled with high serum medium (0.05mg/ml BPE and 5ng/ml EGF). Graph summarizes migrated cells per area (mean ± SD; n=3; **P<0,01; *P>0,05; ns=not significant). Control western blots are shown in Figure 3D.

Figure S3. Transcriptional effects of miR-149-3p overexpression in prostate cancer cells

A) GSEA plots for the hallmark “TNF signaling via NF-κB”, showing specific enrichment in miR-149-3p_UP or siDAB2IP_UP gene sets.

B) Basal expression of validated common genes depends on miR-149-3p. PC3 were transfected with a non-targeting control inhibitor (inh Ctrl) or a specific miR-149-3p inhibitor (inh miR-149-3p) for 48 hours. Expression of indicated genes was measured by RT-qPCR. Values are normalized to histone H3 and compared to samples transfected with control (mean ± SD; n=3; ***P<0,001; **P<0,01). Western blot confirms DAB2IP increase upon miR-149-3p inhibitor transfection.

C-D) miR-149-3p sustains TNF-induced genes transcription.C)PC3 were transfected with control siRNA, DAB2IP siRNAs, or miR-149-3p. 48 hours later, cells were serum starved and treated with TNFα (10 ng/ml) for 20 hours. Expression of indicated genes was measured by RT-qPCR. Values are normalized to histone H3 and compared to siCtrl samples (mean ± SD; n=3; *P<0,05; **P<0,01; ***P<0,001). Control western blot confirms endogenous DAB2IP reduction. D) PC3 were transfected with control inhibitor or miR-149-3p inhibitor for 48 hours, and treated with TNFα as in C. Expression of indicated genes was measured by RT-qPCR. Values are normalized to histone H3 and compared to inh Ctrl samples (mean ± SD; n=3; *P<0,05; **P<0,01). A control western blot is shown on the right.

E) miR-149-3p sustains TNF-induced cell invasion. PC3 were transfected and treated as described in C before seeding in matrigel-coated transwell filters in low serum conditions, with or without TNF (10 ng/ml). Graph summarizes migrated cells per area (mean ± SD; n=3; *P<0,05). A control western blot, confirming DAB2IP reduction, is shown.

Figure S4. miR-149-3p is secreted by PC3 and targets DAB2IP in recipient cells

A) Venn diagram showing the overlap between a list of published miRNAs found in PC3 exosomes1, top scoring DAB2IP-targeting miRNA hits identified in our screening, and DAB2IP-targeting miRNAs suggested by miRWalk and Target Scan prediction algorithms. Arrows indicate 17 different miRNAs predicted to target DAB2IP that are secreted by PC3 cells. miR-149-3p is marked in red.

B) PC3-conditioned medium increased miR-149-3p levels in non-transformed recipient cells. PWR-1E cells were treated with control (Ctrl) or PC3-conditioned medium (CM_PC3) for 48 hours. RT-qPCR data were normalized on RNU6B levels and compared to Ctrl medium (mean ± SD; n=3; *P<0,05).

C) PC3-conditioned medium increases miR-149-3p/DAB2IP-related genes expression in non-transformed recipient cells. PWR-1E cells were treated with control (Ctrl) or PC3-conditioned medium (CM_PC3) for 48 hours. RT-qPCR data were normalized on H3 levels and compared to Ctrl medium (mean ± SD; n=3; *P<0,05; **P<0,01).

D) Expression of a miR-149-3p-specific antisense sponge increases endogenous DAB2IP protein levels in prostate cells. PWR-1E cells were infected with a TW3 lentiviral vector either empty (TW3 empty) or expressing a specific miR-149-3p sponge (TW3 S149-3p). Lysates were analyzed by Western blot. Reduced GFP levels in cells transduced with TW3 S149-3p indicates that the sponge construct (encodingeGFP) is targeted by endogenous miR-149-3p. Actin was blotted as loading control.

E)PC3-conditioned medium reduces DAB2IP protein levels in human endothelial cells. HUVEC from two different donors were treated with control (Ctrl) or PC3-conditioned medium (CM_PC3) for 48 hours. DAB2IP protein levels were determined by western blot.

F)PC3-conditioned medium increased miR-149-3p levels in human endothelial cells. HUVEC were treated with control (Ctrl) or PC3-conditioned medium (CM_PC3) for 48 hours. RT-qPCR data were normalized on RNU6B levels and compared to Ctrl medium (mean ± SD; n=4; **P<0,01).

G) PC3-conditioned medium increases expression of angiogenesis-related genes in human endothelial cells. HUVEC were treated with control (Ctrl) or PC3-conditioned medium (CM_PC3) for 48 hours or 72 hours, as indicated. RT-qPCR data were normalized on H3 levels and compared to Ctrl medium (mean ± SD; n=3; *P<0,05; **P<0,01).

H) Murine DAB2IP is a candidate target for human miR-149-3p. Schematic representation of six target sites (seed sequence) for human miR-149-3p present in the 3’UTR of mouse DAB2IP (ENSMUST00000112987.2) according to Target Scan prediction.

I) Human miR-149-3p down-regulates murine DAB2IP. Mouse embryo fibroblasts were transfected with human miR-149-3p mimics for 48 hours. Endogenous mDAB2IP levels were measured by western blotting, with Actin as loading control.

SUPPLEMENTARY MATERIALS AND METHODS

Cell culture and treatments

PC3, LNCaP (prostate cancer) and H1299 (non small cells lung carcinoma) were cultured in RPMI medium (Lonza) supplemented with 10% FBS (ECS0180L, Euroclone) and antibiotics (ECB3001D, Lonza). HeLa (cervix adenocarcinoma), SKOV-3 (ovarian cancer), HBL100 (breast cancer), HCT116 (colon carcinoma), 293GP and 293T were cultured in DMEM medium (Lonza) supplemented with 10% FBS and antibiotics. HePG2 (hepatocellular carcinoma) were culture in EMEM medium (Lonza) supplemented with non essential amino acid (Lonza), 10% FBS and antibiotics. RWP-1E and PWRE-1 (non-transformed prostate epithelial cells) were cultured in Keratinocyte-SFM (Life Technologies) supplemented with bovine pituitary extract (BPE 0.05mg/ml), human recombinant epidermal growth factor (EGF 5ng/ml) and antibiotics. MCF10A (non-transformed mammary epithelial cells) were maintained in DMEM:F12 Ham’s medium 1:1, supplemented with 5% horse serum, insulin (10 μg/ml), hydrocortisone (0.5 μg/ml) and epidermal growth factor (EGF 20 ng/ml). All human cell lines were subjected to STR genotyping with PowerPlex 18D System and confirmed in their identity comparing the results to reference cell databases (DMSZ, ATCC, and JCRB databases), where possible.

HUVECs (Human umbilical vein endothelial cells) were isolated by collagenase treatment and cultured as previously described 2. The cells were seeded in 25-cm2 flask precoated with 2 μg/cm2fibronectin (Roche, Milan, Italy) and maintained in endothelial serum-free basal medium (Life Technologies, Milan, Italy) supplemented with 20ng/ml bFGF (basic Fibroblast Growth Factor), 10ng/ml EGF (Epidermal Growth Factor) (Life Technologies) and 10% of FBS (ECS0180L, Euroclone). The study was approved by the institutional review board of The Maternal-Children’s Hospital (IRCCS “BurloGarofolo”, Trieste, Italy) and informed consent was obtained from all patients providing the placental tissue specimens. All the experiments were carried out within the third passage of cell culture.

For preparation of conditioned medium, cells were cultured for 30 hours, then medium was collected, centrifuged, and filtered using 0.22m filters. Conditioned medium was used immediately or kept a 4°C for up to 1 week.

Human TNF was purchased from Invitrogen (PHC3015). Cells were treated with recombinant TNF (10ng/ml) in low serum (0.1% FBS) for 20 hours.

Transfection

For siRNA, miRNAs, miRNA inhibitors and Target Protectors transfections, cells were plated and transfected the day after with 50 nMsiRNA oligonucleotides, 3nM miRNAs mimics, 20nM miRNAs hairpin inhibitors and Target protectors, using LipofectamineRNAiMax (Invitrogen), following manufacturer’s instructions. After 48 hours of silencing, cells were processed.

siDAB2IPa (GGAGCGCAACAGUUACCUG), siDAB2IPb (GGUGAAGGACUUCCUGACA), siDAB2IP 3’UTR (GUAAUGUAACUAUCUCACC) and sip65 (GCCCUAUCCCUUUACGUCA) were purchased from Eurofins MWG. Control siRNA was purchase from Qiagen (All star negative control, 1027281).

Human miRNAmimics and HairpinInhibitorswerepurchased from Dharmacon.

CatalogNumber / Mature Accession / Mature Name / Mature Sequence
C-301151-01 / MIMAT0004609 / hsa-miR-149-3p / AGGGAGGGACGGGGGCUGUGC
C-300486-05 / MIMAT0000071 / hsa-miR-17-3p / ACUGCAGUGAAGGCACUUGUAG
C-300498-05 / MIMAT0000081 / hsa-miR-25-3p / CAUUGCACUUGUCUCGGUCUGA
C-301089-01 / MIMAT0004748 / hsa-miR-423-5p / UGAGGGGCAGAGAGCGAGACUUU
C-300873-01 / MIMAT0003219 / hsa-miR-555 / AGGGUAAGCUGAACCUCUGAU
C-300901-01 / MIMAT0003247 / hsa-miR-582-5p / UUACAGUUGUUCAACCAGUUACU
C-301251-01 / MIMAT0004957 / hsa-miR-760 / CGGCUCUGGGUCUGUGGGGA
C-300510-05 / MIMAT0000092 / hsa-miR-92a-3p / UAUUGCACUUGUCCCGGCCUGU
C-300872-03 / MIMAT0003218 / hsa-miR-92b-3p / UAUUGCACUCGUCCCGGCCUCC
C-300514-07 / MIMAT0000095 / hsa-miR-96-5p / UUUGGCACUAGCACAUUUUUGCU
C-300631-07 / MIMAT0000450 / hsa-miR-149-5p / UCUGGCUCCGUGUCUUCACUCCC
C-300633-03 / MIMAT0000452 / hsa-miR-154 / UAGGUUAUCCGUGUUGCCUUCG
IH-301151-02-0002 / MIMAT0004609 / hsa-miR-149-3p / Unknown
IN-001005-01-05 / HairpinInhibitor Negative Control / Unknown

miScript Target Protectors and Negative Control Target Protector werepurchased from Qiagen: Negative Control Target Protector (MTP0000002), Target Protector DAB2IP 1 (MTP0076757, 5’TGCTGGAGAAAGCCACGCCCTCCCTGCTAG3’), Target Protector DAB2IP 2 (MTP0076750, 5’CTCTTCTCTCCCCAGCCCCCTCCCACCGCT3’) and Target Protector DAB2IP 3 (MTP0076743, 5’TTCTGTAGCTTATCTGCCCCTCCCCCACTT3’).

Viral Transduction

For Retrovirus and Lentivirus production HEK-293GP and HEK-293T cells were transfected with the packaging plasmids and the plasmid construct of interest, using standard calcium-phosphate method or Fugene reagent (Promega), respectively. After 8 hours, medium was changed and cells were incubated at 37°C. After 48 hours, the supernatants containing viral particles were filtered (0.45 μm filter), supplemented with 10% FBS and polybrene (8ug/ml). The culture medium of target cells growing at low confluence (≈30-40%) was replaced by the appropriate viral supernatant and incubated at 37°C for 24 hours. Cells were selected with puromycin (0,5 μg/ml) and kept under selection for the entire experiment.

Plasmids

psiCHECK2 DAB2IP 3’UTR was generated by amplifying DAB2IP 3’UTR (NM_032552.2) from genomic DNA extracted from H1299 cells and subsequently cloning it into psiCHECK2 (Promega) downstream of Renilla Luciferase reporter gene, between NotI and XhoI restriction sites. The psiCHECK2 vector also expresses Firefly Luciferase, which is used to normalize for the efficiency of plasmid transfection. pLPC DAB2IP was obtained by cloning mouse DAB2IP (mDAB2IP) transcript variant 1 (NM_001114125.1) into pLPC empty vector. miR-149-3p specific sponge sequence (S149-3p) was designed as previously described 3. A 283 nt long sequence, containing 8 bulge sites specific for miR-149-3p, with linker in between, was synthesized by DNA2.0 (Menlo Park, CA) and subcloned downstream of eGFP into the TWEEN 3’UTR lentiviral vector (kindly provided by R. De Maria).

High-throughput screening

The library of miRNA mimics (miRIDIANmiRNA mimics) corresponding to all the human mature miRNAs (988 miRNAs, 875 unique sequences, miRBase 13.0) was obtained from Dharmacon, GE Healthcare. For the screening experiments, miRNA mimics were transferred robotically from stock library plates to 384-well white plates (PerkinElmer). miRNA mimics were transfected into HeLa cells through a standard reverse transfection protocol using LipofectamineRNAiMAX (Life Technologies), at a final miRNA concentration of 50 nM, as described previously 4. Twenty-four hours after transfection, cells were transfected with the reporter plasmid psiCHECK2 DAB2IP 3’UTR (12 ng/well), mixed with pUC plasmid (100 ng/well), using FuGENE HD transfection reagent (Promega), according to the manufacturer’s instructions. 48 hours after plasmid transfection, which correspond to 72 h after cell seeding and miRNA mimic transfection, cells were lysed in GloLysis Buffer (Promega) and Firefly and Renilla activities were measured using Dual-Glo Luciferase Assay System (Promega) in a PerkinElmer Envision multimode plate reader. The primary screening was performed in duplicate at the ICGEB High-Throughput Screening Facility (

For the secondary screening, cells were reverse transfected with 111 miRNA mimics selected from the primary screening and subsequently transfected with the empty psiCHECK2 plasmid, used to exclude effects not related with DAB2IP 3’UTR. All procedures were performed as described for the primary screening.

Protein analysis

Total cell extracts were prepared in RIPA buffer without SDS (150mM NaCl, 50mM Tris-HCl pH8, 1mM EDTA, 1% NP-40, 0.5% Na-deoxycholate) supplemented with 1 mM PMSF, 5 mMNaF, 1 mM Na3VO4 and 10μg/ml CLAP. Protein concentration was determined with Bio-Rad Protein Assay Reagent (#500-0006, Bio-Rad). Lysates were resolved by SDS/PAGE and transferred to nitrocellulose (Millipore). Western blot analysis was performed according to standard procedures using the following primary antibodies: actin (#A9718, Sigma), DAB2IP (A302-440A, Bethyl), Tubulin (T5168, Sigma), p65 RelA (sc-372X, Santa Cruz), Lamin A/C (sc-6215, Santa Cruz) and GFP (home-made rabbit polyclonal). Anti-goat, anti-mouse and anti-rabbit HRPO-conjugated (Sigma), were used as secondary antibodies.

Nucleus-cytoplasm fractionation

Cells were washed two times in PBS and scraped in Cytoplasmic-buffer (10mM HEPES pH7.9, 1.5mM MgCl2, 10mM KCl, 0.5mM DTT, 0.1% NP-40) supplemented with inhibitors (1mM PMSF, 5mM NaF, 10mg/ml CLAP, 1mM Na3VO4); lysis was obtained gently pipetting a couple of times. After 3 minutes in ice, lysates were centrifuged at 2500g for 5 minutes at 4°C; the supernatant was collected as the cytoplasmic fraction. The pellet was washed twice in Wash-buffer (10mM HEPES pH7.9, 1.5mM MgCl2, 10mM KCl, 0.5mM DTT) and then Nuclei in the pellet were resuspended in Nuclear-buffer (20mM HEPES pH7.9, 1.5mM MgCl2, 420mM NaCl, 0.2mM EGTA, 0.5mM DTT, 25% glycerol) supplemented with inhibitors (1mM PMSF, 5mM NaF, 10mg/ml CLAP, 1mM Na3VO4); after 30 minutes of incubation in ice, nuclear extract was recovered by centrifugation at 15000g for 15 minutes at 4°C.

RNA extraction and RT-qPCR

Total RNA was extracted with QIAzol (Qiagen) following manufacturer’s instructions. For analysis of miRNA expression in culture medium, cel-39 miRNA mimic (0.2nM) was previously added to QIAzol.

For mRNA expression analysis, 1g of total RNA was reverse-transcribed with QuantiTect Reverse Transcription (Qiagen). Analyzed genes were amplified using SsoAdvancedTMSYBR® Green Master Mix (Biorad) on a CFX96™ Real-Time PCR System (Biorad).

For microRNAs expression analysis, 1ug of RNA was retro-transcribed with miScript PCR System (Qiagen). miR-149-3p, miR-149-5p, the other microRNAs studied and the control housekeeping genes U6B and SNORD25 small nuclear RNAs were amplified with miScript SYBR Green PCR kits (Qiagen), following manufacturer’s instructions on a CFX96™ Real-Time PCR System (Biorad).

List of primersused:

Target / Sequence
DAB2IP / Fw: 5’CACATCACCAACCACTAC3’
Rev: 5’TCCACCTCTGACATCATC3’
CCL20 / Fw: 5’ CAGTGCTGCTACTCCACCTC3’
Rev: 5’ AAAGTTGCTTGCTGCTTCTGA3’
CSF2 / Fw: 5’AATGTTTGACCTCCAGGAGCC3’
Rev: 5’TCTGGGTTGCACAGGAAGTT3’
IL8 / Fw: 5’GGCAGCCTTCCTGATTTCTG3’
Rev: 5’CTTGCCAAAACTGCACCTTCA3’
FGF2 / Fw: 5’GGCTTCTTCCTGCGCATCCA3’
Rev: 5’GCTCTTAGCAGACATTGGAAGA3’
VEGFA / Fw: 5'GTATAAGTCCTGGAGCGTGT3'
Rev: 5'TCAGTCTTTCCTGGTGAGAG3'
PTX3 / Fw: 5’ GCGGTGCTAGAGGAGCTG3’
Rev: 5’ GCCTCATTGGTCTCACTGGA3’
BIRC3 / Fw: 5’ AGCTGAAGCTGTGTTATATGAGC3’
Rev: 5’ ACTGTACCCTTGATTGTACTCCT3’
COL6A1 / Fw: 5’ CACTCAAAAGCAGCGTGGAC
Rev: 5’ GTCGGTCACCACAATCAGGT3’
COL6A2 / Fw:5’ GAGCCTCCTCGGGACCA3’
Rev: 5’ AGGATTCCCCAGAGCAGGAG3’
CLDN8 / Fw: 5’AGAGTGTCGGCCTTCATTGA3’
Rev: 5’AGAAGGACATCACGGAAGCA3’
ITGA3 / Fw:5’GGCAGACCTACCACAACGAG3’
Rev:5’CTACCTGCATCGTGTACCCA3’
RhoF / Fw:5’AAGATCGTGATCGTGGGCG3’
Rev:5’ AGCTGGTGGGATTCATGACG3’
H3 / Fw: 5’GAAGAAACCTCATCGTTACAGGCCTGGT3’
Rev: 5’CTGCAAAGCACCAATAGCTGCACTCTGGAA 3’
AssayName / OfficialSymbol / CatalogNumber / Purchase from
Hs_SNORD25_11 / SNORD25 / MS00014007 / Qiagen
Hs_RNU6B_13 / RNU6B / MS00014000 / Qiagen
Hs_miR-149-5p_1 / MIR149 / MS00003570 / Qiagen
Hs_miR-149-3p_3 / MIR149 / MS00037702 / Qiagen
Ce_miR-39_1 miScriptPrimerAssay / MIR39 / MS00019789 / Qiagen

Cell migration invasion and proliferation assays

For transwell migration assays, cells (1x105) were plated on 24 well PET inserts (8.0 m pore size, Falcon). After 16 hours, cells that passed through the filter were fixed in 4% PFA, stained with 0.05% crystal violet and counted. For invasion assays, cells (0.5-1x105) were plated on 24 well PET inserts (8.0 m pore size, Falcon) coated with BD MatrigelTM (BD Bioscience). Cells that passed through the matrigel-coated filter were fixed, stained, and counted after 18 hours. Specifically, for both invasion and transwell migration assays, cells were seeded on filters in low serum (0.1% FBS or 0% BPE/EGF); the lower chamber was filled with high serum medium (10% FBS or BPE 0.05mg/ml and EGF 5ng/ml).

In experiments with conditioned medium, cells were pre-incubated with Ctrl or PC3-conditioned medium for 24h, and subsequently seeded on filters in the presence of Ctrl or PC3-conditioned medium. The lower chamber was filled with high serum medium (BPE 0.05mg/ml and EGF 5ng/ml).

HUVEC migration assays were performed as previously reported 5, coating the lower side of the polycarbonate transwell filter (8µm pore size, Corning Costar) with fibronectin (Roche, 5µg/cm2). HUVECs (2x105 cells) were pre-incubated with Ctrl or PC3-conditioned medium for 24h, and seeded in the upper compartment. The lower compartment of the transwell system was filled with Ctrl or PC3-conditioned medium. The cells were allowed to migrate for 18 h at 37°C 5% CO2. The number of migrated cells was determined using a Beckman Coulter Z1 particle counter.