Fall Final Review Packet

FALL FINAL REVIEW PACKET

Cell Diagrams

Introduction to Science

Turn to page 13 and define the following:

1. Observation:

1. Hypothesis:

1. Prediction:

Turn to page 1070. For the following microscope structures indicate the appropriate letter.

1. ______Low power objective
2. ______Diaphragm
3. ______Coarse adjustment knob
4. ______Eyepiece
5. ______Fine focus knob
6. ______Base

Enzymes

Chemical Reactions (use pages 36-37)

1. Circle the products in this reaction and box the reactants.

CO2 + H2O  H2CO3

1. Define activation Energy (36)

1. Use page 35. Write the term “products” and “reactants” in the correct place in the graph .

Enzymes

1. Catalysts speed up/slow down reactions (circle one).
2. Define enzyme (36).

1. What do enzymes lower?

1. Add a dashed line to the graph above to show what a reaction would look like if an enzyme was present.
2. Turn to page 57 and read the passage about enzymes. What type of macromolecule are enzymes (carbohydrate, protein, lipid, or nucleic acid)?

1. Draw figure 3-9 and label the following parts: enzyme, substrate, products.

1. Read further on this page. What environmental changes can affect enzyme activity? Why would the enzyme no longer work the same?

Macromolecules

Directions: Use pages 51-60 to answer the following questions.

1. Look at figure 3-3 on page 53. Describe the relationship between monomers and polymers.

1. Put the following in order from smallest to largest: macromolecule, monomer, polymer.

1. Fill in the chart below.

Cell Structure

1. Fill in the table below.

1. How is a prokaryote cell different from a eukaryote cell?

1. How do plant and animal cells differ in their structure?

Cell Membrane

Draw and label a phospholipid on page 77.

1. Draw and label the phospholipid bi-layer cell membrane on page 78. Color the heads red, the tails green, protein yellow, and the carbohydrate chain blue, and cholesterol purple.

1. What does it mean to be semi-permeable?

Passive Transport (97-102)

1. Passive transport moves molecules across the membrane with or without the use of energy?

1. Define diffusion.

1. Define osmosis.

Active Transport (103-106)

1. How is the movement of molecules different in active transport versus passive transport?

1. Give three examples of active transport.

Cell Energy

1. What molecule is known as the Energy Currency for cells (pg. 54)?

Photosynthesis

1. Explain figure 6-12 on page 124

1. Look at figure 6-5 on page 115. Which colors of light does chlorophyll absorb most and which does it absorb the least?

1. Define autotroph (113):

1. Write the equation for photosynthesis and label the reactants and products under the equation (114).

1. Draw and label a chloroplast (114).

1. What molecule is found in the thylakoid membrane which absorbs light and is responsible for making leaves green?

1. What environmental factors increase the rate of photosynthesis (124)?

Cellular Respiration

1. Define cellular respiration.

1. Write the equation for cellular respiration and label the reactants and products under the equation (132).

1. What are the products of photosynthesis that are the reactants of cellular respiration?

1. Look at the picture to the right. Label where a) glycolysis occurs b) aerobic respiration (Kreb’s cycle and Electron Transport Chain) and c) fermentation occurs.

DNA and Central Dogma

Directions: Read pages 193-210 and answer the questions below

1. Name three ways RNA is different from DNA.

1. Transcribe the following DNA into RNA

A-T-T-G-G-A-C-T-C-G-A-T-C-A-

1. Define codon:

1. How many codons does this segment of RNA have? UACUUUCGAACACUGCGCUCA ______

1. Translate this segment of DNA into Amino Acids using the genetic code on page 207

DNA: TAC TTT CGA ACA CTG CGC TCA

RNA:

AA:

1. Define Mutation

1. Turn to page 208. Read the paragraph titled “Protein Structure” and answer the questions below.
2. How many different amino acids are there?
3. How can different types of proteins be made using the same 20 amino acids?

1. The amino acid ______determines how the polypeptide will fold.
2. The shape of the protein determines its ______.
3. Why could one base mutation have an effect on the function of a protein?

10. Explain this statement, “the genetic code is universal”.

Biotechnology

1. Define Genetic Engineering (258)

1. What is recombinant DNA?

1. What role do restriction enzymes play in making recombinant DNA?
2. Draw an image showing a plasmid with recombinant DNA. Use Figure 13-6 on page 259.

Cell Cycle

Chromosome Structure

Use pages 151-153 to answer the following questions.

1. Draw and label a picture of a chromosome.

1. Fill in the table below.

1. If a diploid cell is 2n = 36, then a haploid cell is ______= _____.
2. How is sex (or gender) determined in humans?
3. The genotype for a male is ______and the genotype for a female is ______.

Mitosis

Use pages 155-157 to answer the following questions. Figures 8-5 and 8-6 will be very helpful.

1. During the cell cycle, what major process occur during

a)Interphase?

b)Mitosis?

c)Cytokinesis?

1. Draw the chromosomes in each of the four phases of mitosis in the circles below. Briefly explain what is happening in each stage.

PROPHASE METAPHASE ANAPHASE TELOPHASE

Meiosis

Use pages 161-164 to answer the following questions.

1. a) Define (or describe what happens in) the following words below.

Chromatids:

Crossing over:

Gametes:

Homologous chromosomes:

Meiosis II:

b)Fill in the concept map with each of the terms you just defined.

1. Other than crossing over, what also increases genetic variation (page 318)?
2. a) What is independent assortment?

b)When does independent assortment occur?

c)What does independent assortment result in?

11. Look at the diagram of meiosis on the right. Indicate on the diagram when a) homologous chromosomes are separated and b) when sister chromatids are separated.

1. What is a zygote and how is a zygote produced (page 1056)?

Comparing Meiosis and Mitosis

1. Fill in the table below.

1. Explain how the process of mitosis differs from that of mitosis.

1. How is prophase of mitosis differ from prophase I of mitosis?

Genetics

Mendel’s Ideas

Use pages 177-185 for the following questions.

1. Define:

a) Allele:

b) Gene:

2. Indicate whether each statement reflects the law of independent assortment (A) or the law of segregation (S).

______Traits are transmitted to offspring independently of one another.

______Each parent will give only one of their alleles for a trait to the child during fertilization to form the zygote.

3. If the gene pairs are identical, a person is called ______.

4. If the gene pairs are different, a person is called ______.

5. Define:

a) Genotype:

b) Phenotype:

6. In complete dominance one ______is completely ______over the other.

7. How can you determine which trait is recessive and which trait is dominant?

8. In pea plants, green (G) is dominant to yellow (g).

a) A homozygous yellow plant would have what genes for this trait?

b) What is the phenotype for a plant with the genotype Gg?

Punnett Squares

9. If a homozygous green plant is crossed with a homozygous yellow plant, what genotypes and phenotypes would you expect the offspring to have? Use the Punnett square to the right.

Cross: ______X ______

10. A cross between two heterozygous parents, where Blue (B) is dominant to white (b), what are the phenotypic and genotypic ratios of the offspring?

Cross: ______X ______

Phenotypic Ratio: ______: ______

Genotypic Ratio: ______: ______: ______

11. What is a(n) (pg 152)

a) autosome:

b) sex chromosome:

Use pages 236-237 for the following questions.

12. The genotype for a female is ______and the genotype for a male is ______.

13. A normal dominant trait could be represented by the allele D, where as the recessive autosomal allele could be represented by a d. The possible genotypes would be DD, Dd, and dd. The If the traits were sex-linked, what would be the possible genotypes?

14. The last heir to the Russian throne, Alexei Nikolaevich,suffered from hemophilia. People who suffer from hemophilia have the inability to control blood clotting. His mother and father did not suffer from the disorder. Using a punnet square show how this is possible.

Use page 239

15. The term lethal means “deadly”. Often a lethal allele is recessive. Why would there be less people in the population likely to suffer from a lethal trait. Give me two reasons.

a)

b)

16. What do we mean when we say someone is a carrier for a lethal disease?

1