Supplementary Information
Environmental distribution and abundance of the facultative methanotroph Methylocella
Md.Tanvir Rahman, Andrew Crombie, Yin Chen, Nancy Stralis-Pavese, Levente Bodrossy, Patrick Meir, Niall P. McNamara, and J. Colin Murrell
Materials and methods
PCR protocol for amplification of Methylocella 16S rRNA and mmoX genes
DNA was extracted from soils as described by Chen et al. (2007). Around 30 ng of the total extracted DNA was used as the template for PCR to amplify 16S rRNA and mmoX genes. 16S rRNA genes related to Methylocella were amplified using nested PCR. The first round (30 cycles), using primers 27f/1492r (Lane 1991), was followed by 30 cycles using primers Type IIF (5´-GGGAMGATAATGACGGTACCWGGA-3´) and Mcell-1445 (5´- CCTCTCTCCTTGCGGTT-3´), with 1 μl of the first round product as template. In some cases one round was sufficient, and it was possible to dispense with the first (non-specific) round of PCR. Initially the presence of substances that inhibit PCR, such as humic acids, was ruled out by amplifying bacterial 16S rRNA genes from DNA (30 ng) extracted from all the samples tested here using primers 27f/1492r. The cycling conditions were 94° C for 5min, followed by 30 cycles of 94° C for 1min, 55° C (primers 27f/1492r) or 63° C (primers Type IIF/Mcell-1445) for 1min, 72° C for 1min, with a final extension at 72° C for 10min.
Methylocella genus-specific mmoX forward primer mmoXLF (5´-GAAGATTGG GGCGGCATCTG -3´) and reverse primer mmoXLR (5´- CCCAATCATCGCTGAAGGAGT -3´) were designed to amplify mmoX from Methylocella spp. Initially all the available mmoX gene sequences covering both type I and type II methanotrophs were downloaded from the GenBank database and analysed using the ARB software package (Ludwig et al., 2004). The sequence alignment was manually verified for alignment accuracy. Potential primers were identified and their specificity tested using the Probe Match function of ARB. The primers were analysed for hairpin structures and potential duplex formation using the OLIGO 6 program (http://www.oligo.net/oligo.htm). For the amplification of Methylocella mmoX by conventional PCR, two consecutive rounds of PCR were adopted using primers mmoXLF and mmoXLR, where 1 µl of PCR product from the first round was used as template DNA for a second round of PCR (2 ´ 30 cycles). The PCR cycling conditions were 94° C for 5min, followed by 30 cycles of 94° C for 1min, 68° C for 1min, 72° C for 1min, with a final extension at 72° C for 10min. Both Methylocella mmoX and 16S rRNA gene-targeting PCR conditions were optimized with DNA from pure cultures of Methylocella silvestris, Methylocella palustris, Methylocella tundrae, Methylocystis parvus, Methylomonas agile, Methylomonas rubra, Methylomonas methanica, Methylosinus trichosporium and Methylosinus sporium. Specificity of these primers to detect Methylocella mmoX and 16S rRNA genes in environmental DNA was verified by clone library analysis (Table 1).
4
Real-time quantitative PCR
Methylocella mmoX-specific primers mmoXLF and mmoXLR were applied in a SYBR-Green based real-time quantitative PCR (qPCR) assay to quantify the Methylocella population present in the environment. qPCR assays were conducted in polypropylene 96-well plates on an ABI PRISM ® 7000 Sequence Detection System (Applied Biosystems). All assays were carried out in triplicate in a 25 µl volume containing 12.5 µl Power SYBR® Master Mix (Applied Biosystems, UK), 1 µl (10 µM; Invitrogen, UK) of primer mmoXLF and moXLR, 0.5 µl of 3.2% (w/v) BSA (Roche, Switzerland), 2 µl template DNA (1/10 to 1/100 dilution of the extracted DNA) and water 8 µl. Non-template controls (NTCs) were also run in triplicate in each assay. A two-step qPCR protocol was adopted, consisting of an initial denaturation at 95 º C for 5 minutes followed by 45 cycles of denaturation at 95 ° C for 15 seconds and combined annealing and elongation at 68 ° C for 1 min. Absolute quantification of mmoX copies was achieved by comparing the reaction Ct (threshold cycle) value with a standard curve, made from a dilution series of M. silvestris BL2 genomic DNA ranging from 102 copies to 106 copies per reaction (Supplementary Figure S1). The concentration of genomic DNA was determined by measuring the absorbance at 260 nm using a NanoDrop spectrophotometer (ND-1000; NanoDrop™, USA). Gene copies were calculated according to the method described by Fogel et al. (1999) using the mass of the M. silvestris BL2 genome (approximately 4.3 Mb). Only one copy of mmoX is present in the genome of M. silvestris BL2 (accession number CP001280). Therefore we assume that the number of mmoX copies present in a particular sample represents the number of Methylocella spp. cells in that sample. A fluorescence amplification plot of 10-fold serial dilutions of M. silvestris BL2 genomic DNA and NTCs is shown in Supplementary Figure S2. Amplification of specific single amplicons and the absence of primer-dimer formation were confirmed by melting-curve analysis (Supplementary Figure S3). During melting-curve analysis, the temperature was increased from 60° C to 95° C at approximately 2° C min-1. The qPCR assay was validated by a spiking study with the Ufton landfill cover soil (UK). Five g soil was spiked in triplicate with known amounts of M. silvestris BL2 cells ranging from 103 to 105 cells g-1 soil. M. silvestris BL2 cells in pure culture were quantified by microscopy (Axiophot; Zeiss) using a Neubauer cell counting chamber (Glaswarenfabrik Karl Hecht KG, Sondheim, Germany). Detection of Methylocella-specific mmoX sequences in the amplified qPCR product was verified by cloning and sequencing (data not shown).
Quantification of pmoA copy number in DNA extracted from selected environmental samples was carried out using primers A189F and Mb661R at an annealing temperature of 52° C according to the method described by Kolb et al., (2003). Standards were generated using Methylosinus trichosporium genomic DNA ranging from 102 to 107 copies of pmoA per reaction.
Construction of mmoX and 16S rRNA gene clone libraries, restriction fragment length polymorphism analysis and sequencing
Before cloning, PCR products were run on a 1% (w/v) agarose gel to check for size and PCR specificity. PCR products of the correct size were excised from the gel and purified using the Qiagen gel purification kit (Qiagen, USA) according to the manufacturer's instructions. Purified PCR products were ligated into plasmid pCR2.1 (Invitrogen, San Diego, CA, USA) according to the manufacturer's instructions, cloned and inserts were amplified using M13F/M13R primers. PCR products were subjected to restriction fragment length polymorphism analysis by digesting with RsaI (for mmoX) and MspI (for 16S rRNA genes). Digested DNA fragments were resolved by electrophoresis in a 2.5% (w/v) agarose gel. Clone inserts displaying identical restriction patterns were grouped into operational taxonomic units (OTUs). One to two clones were sequenced per OTU. DNA sequencing was performed at the University of Warwick Molecular Biology Facility by cycle sequencing with a BigDye Dideoxy Terminator Ready Reaction kit (Applied Biosystems, Warrington, UK) and ABI3100 capillary DNA sequencers. The identities of the cloned sequences were determined by BLASTn searches of the GenBank database (Altschul et al., 1990), and the phylogenetic affiliations of 16S rRNA gene sequences were determined using RDP classifier (Cole et al., 2008).
References
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990). Basic local alignment search tool. J Mol Biol 215: 403-410.
Chen Y, Dumont MG, Cébron A, Murrell JC. (2007). Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes. Environ Microbiol 9: 2855-2869.
Cole JR, Wang Q, Cardenas E, Fish J, Chai B, Farris RJ et al. (2009). The Ribosomal Database Project: improved alignments and new tools for rRNA analysis. Nucleic Acids Res 37: 141-145.
Fogel GB, Collins CR, Li J, Brunk CF. (1999). Prokaryotic genome size and SSU rDNA copy number: estimation of microbial relative abundance from a mixed population. Microbial Ecol 38: 93-113.
Heid CA, Stevens J, Livak KJ, Williams PM. (1996). Real time quantitative PCR. Genome Res 6: 986-994.
Kolb S, Knief C, Stubner S, Conrad R. (2003). Quantitative detection of methanotrophs in soil by novel pmoA-targeted real-time PCR assays. Appl Environ Microbiol 69: 2423-2429.
Lane DJ. (1991). 16S/23S rRNA sequencing. In: Stackebrandt E, Goodfellow M (eds). Nucleic Acid Techniques in Bacterial Systematics. John Wiley & Sons: New York, NY, USA. pp 115–147.
Ludwig W, Strunk O, Westram R, Richter L, Meier H, Yadhukumar et al. (2004). ARB: a software environment for sequence data. Nucleic Acids Res 32: 1363-1371.
Supplementary Information
Figures
Supplementary Figure S1
Standard curve Ct value against template DNA mass. The Ct value is defined as the number of cycles at which the accumulation of amplicons, as measured by an increase in fluorescence, reaches a predetermined level significantly above the background (Heid et al., 1996).
Supplementary Figure S2
Fluorescence amplification plot of 10-fold serial dilutions (102 to 106 copies) of M. silvestris BL2 genomic DNA (standards) and the non-template control (NTC).
Supplementary Figure S3
Melting-curve analysis for the mmoX amplicons generated from DNA extracted from environmental samples using Methylocella-specific mmoX primers.
Supplementary Figure S4
Alignment of mmoX gene sequences of Methylocella spp. and mmoX from closely related methanotrophs. Conserved regions selected to design the Methylocella genus-specific forward primer (mmoXLF) and reverse primer (mmoXLR) are indicated by boxes. Numbers represent the position of the primers with respect to the mmoX nucleotide sequence of Methylocella silvestris BL2.
Supplementary Table 1.
Total number of mmoX and pmoA gene copies per gram of soil or sediment
Source of samples / mmoX gene copies / pmoA gene copiesHornavan (Sweden) / 3.3 (± 0.6) ´ 106 / 3.8 (± 0.5) ´ 109
Uddjaure (Sweden) / 2.1 (± 0.5) ´ 106 / 2.9 (± 0.1) ´ 109
Moor House peat (UK) / 2.3 (± 0.6) ´ 106 / 2.5 (± 0.3) ´ 108
Colne Estuary sediment, Essex (UK) / 0.9 (± 0.2) ´ 106 / 1.8 (± 0.1) ´ 107
Cloud forest, San Pedro (Peru) / 1.2 (± 0.6) ´ 106 / 1.6 (± 0.2) ´ 108
Rain forest, Tono (Peru) / 2.7 (± 0.9) ´ 106 / 1.2 (± 0.1) ´ 108
Lonar lake sediment (India) / Below detection limit / Not done
Svalbard (Arctic) / Below detection limit / Not done
4