Dual Function of the Mcas Small RNA in Controlling Biofilm Formation

SUPPLEMENTAL INFORMATION

Dual function of the McaS small RNA in controlling biofilm formation

Mikkel Girke Jørgensen1,4, Maureen K. Thomason2,3,4, Johannes Havelund1, Poul Valentin-Hansen1,5 and Gisela Storz2,5

1Department of Biochemistry and Molecular Biology, University of Southern Denmark, Odense, Denmark.

2Cell Biology and Metabolism Program, Eunice Kennedy Shriver National Institute of Child Health and Human Development, Bethesda, MD USA.

3Department of Biochemistry and Molecular & Cellular Biology, Georgetown University Medical Center, Washington, DC USA.

4Co-first authors

5Co-corresponding authors Email or

Table of Contents

Supplemental Figure S1Additional truncations of pgaA 5’ UTR. Related to Figure 1.4

Supplemental Figure S2Evidence supporting conservation of McaS and CsrA binding sites. Related to Figure 2.5

Supplemental Figure S3Evidence supporting the dual functionality of McaS mutants, which are defective in 6

CsrA binding but are still able to regulate targets by base pairing. Related to Figure 2.

Supplemental Figure S4Evidence supporting the conclusion that lower expression of McaS mutants is not the 7

primary reason for failure to regulate pgaA-lacZ. Related to Figure 2.

Supplemental Figure S5Evidence supporting the specificity of CsrA for McaS and not other sRNAs such as the9

RyhB sRNA. Related to Figure 3.

Supplemental Figure S6Evidence showing that McaS regulates other CsrA targets such as glgC-lacZ. Related to10

Figure 5.

Supplemental Figure S7Quantitation of McaS, CsrB and CsrC levels throughout growth. Related to Figure 7.11

Supplemental Figure S8Effects of mutations in non-conserved GGA sequences. Related to Figure 2 and Discussion.12

Supplemental Figure S9Evidence supporting the dual binding of CsrA and Hfq to McaS. Related to Figure 714

and Discussion.

Supplemental Table S1List of strains and plasmids used in this study 16

Supplemental Table S2List of oligonucleotides used in this study 20

Supplemental MethodsDetailed descriptions of strain and plasmid construction. 30

Supplemental References 33

Supplemental Figure S1. Assays of PM1205 ΔabgR-ydaL derivatives with (A)pgaA155-lacZand (B) pgaA67-lacZfusions transformed with the control vector, pBR-McaS and plasmids expressing the McaS-2 and McaS-3 mutant derivatives. β-galactosidase activities of the fusions were assayed with either 1 mM IPTG (black bars) or no IPTG (white bars). The average values from three independent assays are shown and error bars are standard deviations of those values.

SupplementalFigure S2.Conservation ofMcaS. Alignment of McaS sequences across closely related species to include representative strains of Escherichia, Shigella, Enterobacter, Citrobacter and Cronobacter. Residues conserved across all species are indicated by an *. Potential CsrA GGA binding sites are highlighted in red.

Supplemental Figure S3. Effects of wild-type and mutant McaS on (A)csgD-lacZ and (B)flhD-lacZ expression. Reporter strains PM1205 ∆abgR-ydaL csgD-lacZand PM1205∆abgR-ydaL flhD-lacZwere transformed with the control vector, pBR-McaS and plasmids expressing the McaS-8 and McaS-9 mutant derivatives. β-galactosidase activities for the fusions were assayed as in SupplementalFig.S1.

Supplemental Figure S4. (A) and (B)Levels of plasmid-expressed wild-type and mutant McaS in NM525 ΔabgR-ydaL (A) andPM1205∆abgR-ydaLpgaA-lacZ (B). Overnight cultures were diluted to an OD600 of ~0.05 in LB and allowed to grow for 1.5 h at 37˚C upon which expression of the wild-type and mutant derivatives was induced with1 mM IPTG for all samples in (A) and for pBR-McaS-2,pBR-McaS-8 and pBR-McaS-11 in (B) or 70 µM IPTG for pBR-McaS, pBR-McaS-3 and pBR-McaS-10 in (B). Total RNA was extracted and 10μg was separated on an 8% polyacrylamide-7M urea gel, transferred to a membrane and probed with 32P-labelled McaS specific oligonucleotide or 5S oligonucleotide as a control. (C) Effects of uniformwild-type and mutant McaS RNA levels on pgaA-lacZ expression.β-galactosidase activities for the samples in (B) were assayed as in Supplemental Fig.S1. Mfold ( predicts multiple possible structures for most of the McaS mutants, many of which are similar to structures predicted for the wild-type RNA.

Supplemental Figure S5. RyhB RNA does not co-purify with CsrA.Strain SØ928 csrA-Flag was grown in LB medium to an OD600 of 1.0. At this point the culture was split and the chelator 2,2′-dipyridyl was added to one culture to induce RyhB synthesis. After 10 min, samples were harvested, cell extracts were prepared and incubated with anti-Flag M2-agarose beads. The beads were collected on a small column, the filtrate was collected (unbound fraction; UB), and the beads were washed with IP buffer (wash fraction, W). Subsequently, the proteins trapped on the beads were eluted with 1M arginine buffer (bound fraction; B). Total RNA was extracted from the three fractions and examined for the presence of CsrB and RyhB RNA by Northern blot analysis.

Supplemental Figure S6. McaS activation of glgC-lacZexpression. The reporter strain PM1205 ∆abgR-ydaLglgC-lacZ was transformed with the control vector, pBR-McaS, plasmids expressing McaS mutant derivatives, and pBR-CsrB. β-galactosidase activity was assayed as in Supplemental Fig. S1.

Supplemental Figure S7. Quantification of CsrB, CsrC and McaS RNA levels for wild-type MG1655 samples shown in Fig. 7.Thesignal for each band was converted tothe concentration of the specific sRNA speciesby comparison with in vitro transcribed sRNA run on the same gel as described (Overgaard et al. 2009). To facilitate the quantification, the in vitrotranscribed sRNAs were labeled with tritium (-3H-CTP) during their synthesis.

Supplemental Figure S8.(A) The sequences of the first 80 nucleotides of wild-type McaS and mutant derivatives. Nucleotides altered for each mutant are boxed.Putative CsrA binding sites are shaded in red.(B) Effects of mutant derivatives on pgaA-lacZ expression. The reporter strain PM1205 ΔabgR-ydaL pgaA234- lacZ was transformed with the control vector, pBR-McaS and plasmids expressing McaS mutant derivatives indicated in (A). β-galactosidase activity was assayed as in Supplemental Fig. S1.Mfold ( predicts multiple possible structures for most of the McaS mutants, many of which are similar to structures predicted for the wild-type RNA.

Supplemental Figure S9.(A) CsrA and Hfq can simultaneously bind McaS and do not cooperate in binding. Samples containing a 5´ end-labeled McaS RNA (0.5 nM) were incubated with increasing amounts of Hfq protein (at the indicated concentrations) in the absence and presence of CsrA protein (5 nM) and examined by gel mobility shift assays. (B) CsrA does not interact with Hfq-bound RprA RNA. Samples containing a 5´ end-labeled RprA RNA (0.5 nM) were incubated with increasing amounts of CsrA protein (at the indicated concentrations) in the presence of Hfq protein (10 nM) and assayed as in (B).

Supplemental Table S1. Strains and plasmids used in this study.
Name / MPK number / Genotype / Source
MG1655 / E. coli F- λ- ilvG- rfb-50 rph-1 / Lab stock
BW25113 / lacIq rrnBT14 ∆acZWJ16 hsdR514 ∆araBADAH33 ∆rhaBADLD78 / (Datsenko and Wanner 2000)
TOP10 / F- mcrA ∆(mrr-hsdRMS-mcrBC) φ80lacZ∆M15 ∆lacX74 nupG recA1 araD139 ∆(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ- / Invitrogen
NM500 / MG1655 mini-λ::tet / N. Majdalani
TR1-5 / MPK0336 / E. coli K-12 TR1-5 csrA::kan / Romeo et al 1993
MG1655-csrA::3xFLAG / MG1655 csrA::3xFLAG::KanR / This study
MG1655 ∆pgaA / MG1655∆pgaA::kan / This study
RH90 / MC4100 rpoS359::Tn10 / (Lange and Hengge-Aronis 1991)
MG1655 ∆rpoS / MG1655 rpoS359::Tn10 / This study
MG1655 ∆pgaA ∆rpoS / MG1655 ∆pgaA, rpoS359::Tn10 / This study
MG1655∆mcaS / MG1655∆mcaS::kan / This study
MG1655∆rpoS∆mcaS / MG1655 rpoS359::Tn10, ∆mcaS / This study
MG1655 ∆pgaA ∆rpoS∆mcaS / MG1655 ∆pgaA, rpoS359::Tn10, ∆mcaS / This study
PM1205 / MPK0122 / MG1655 mal::lacIq, ∆araBAD araC+, lacI'::PBAD-cat-sacB-lacZ, mini λ tetR / (Mandin and Gottesman 2009)
GSO613 / MC4100 Δhfq::cat-sacB / (Zhang et al. 2013)
GSO143 / MPK0385 / EH288 ∆csrB::kan / (Hobbs et al. 2010)
GSO560 / MPK0125 / PM1205 lacI'::PBAD-csgD-lacZ, ∆abgR-ydaL::kan / (Thomason et al. 2012)
GSO564 / MPK0210 / PM1205 lacI'::PBAD-flhD-lacZ, ∆abgR-ydaL::kan / (Thomason et al. 2012)
GSO568 / MPK0228 / NRD686 PM1205 lacI'::PBAD-pgaA234-lacZ, ∆abgR-ydaL::kan / (Thomason et al. 2012)
GSO569 / MPK0106 / MG1655∆abgR-ydaL::kan / (Thomason et al. 2012)
GSO552 / MPK0131 / NM525 ∆abgR-ydaL::kan / (Thomason et al. 2012)
GSO632 / MPK0387 / MG1655 TR1-5 csrA::kan / This study
GSO633 / MPK0386 / MG6155∆csrB::kan / This study
GSO634 / MPK0281 / PM1205 lacI'::PBAD-pgaA155-lacZ / This study
GSO635 / MPK0285b / PM1205 lacI'::PBAD-pgaA155-lacZ, ∆abgR-ydaL::kan / This study
GSO636 / MPK0299 / PM1205 lacI'::PBAD-pgaA108-lacZ / This study
GSO637 / MPK0303 / PM1205 lacI'::PBAD-pgaA108-lacZ, ∆abgR-ydaL::kan / This study
GSO638 / MPK0300 / PM1205 lacI'::PBAD-pgaA67-lacZ / This study
GSO639 / MPK0304 / PM1205 lacI'::PBAD-pgaA67-lacZ, ∆abgR-ydaL::kan / This study
GSO640 / MPK0335 / PM1205 lacI'::PBAD-pgaA30-lacZ / This study
GSO641 / MPK0337 / PM1205 lacI'::PBAD-pgaA30-lacZ, ∆abgR-ydaL::kan / This study
GSO642 / MPK0333 / NRD686 PM1205 lacI'::PBAD-pgaA234-lacZ, ∆abgR-ydaL / This study
GSO643 / MPK0376 / NM500 ∆pgaA::cat / This study
GSO644 / MPK0377 / NRD686 PM1205 lacI'::PBAD-pgaA234-lacZ, ∆abgR-ydaL, ∆pgaA::cat / This study
GSO645 / MPK0382 / NRD686 PM1205 lacI'::PBAD-pgaA234-lacZ, ∆abgR-ydaL, ∆pgaA::cat, TR1-5 csrA::kan / This study
GSO646 / MPK0350 / PM1205 lacI'::PBAD-ydaM-lacZ / This study
GSO647 / MPK0353 / PM1205 lacI'::PBAD-ydaM-lacZ, ∆abgR-ydaL::kan / This study
GSO648 / MPK0356 / PM1205 lacI'::PBAD-ydeH-lacZ / This study
GSO649 / MPK0360 / PM1205 lacI'::PBAD-ydeH-lacZ, ∆abgR-ydaL::kan / This study
GSO650 / MPK0359 / PM1205 lacI'::PBAD-ycdT-lacZ / This study
GSO651 / MPK0363 / PM1205 lacI'::PBAD-ycdT-lacZ, ∆abgR-ydaL::kan / This study
GSO652 / MPK0283 / PM1205 lacI'::PBAD-glgC-lacZ / This study
GSO653 / MPK0287 / PM1205 lacI'::PBAD-glgC-lacZ, ∆abgR-ydaL::kan / This study
GSO654 / MPK0322 / MG1655 mcaS::cat-sacB / This study
GSO655 / MPK0326 / MG1655 mcaS::cat-sacB, mini-λ::tet / This study
GSO656 / MPK0383 / MG1655 mcaS::mcaS-3 / This study
GSO657 / MPK0384 / MG1655 mcaS::mcaS-8 / This study
GSO658 / MPK0401a / NM525 ΔabgR::ydaL::kan, ΔpgaA::cat / This study
Plasmid / Relevant features / Source
pKD4 / (KmR); Km cassette flanked by FRT sites for recombineering; template plasmid / (Datsenko and Wanner 2000)
pKD3 / (CmR); Cm cassette flanked by FRT sites for recombineering; template plasmid / (Datsenko and Wanner 2000)
pKD46 / (AmpR); mini λ Red recominbase expression plasmid for recomineering / (Datsenko and Wanner 2000)
pCP20 / (AmpR); (CmR); pSC101repts, contains FLP recombinase / (Cherepanov and Wackernagel 1995)
pNDM-220 / (AmpR); mini R1, lacIq pA1/O4/O3 / (Gotfredsen and Gerdes 1998)
pNDM-McaS / pNDM-220; pA1/O4::mcaS / (Jørgensen et al. 2012)
pNDM-McaSmut3 / pNDM-220; pA1/O4::mcaSmut3 / This study
pNDM-McaSmut8 / pNDM-220; pA1/O4::mcaSmut8 / This study
pSUB11 / (AmpR); R6KoriV, template plasmid for 3x FLAG construction linked to Kan cassette / (Uzzau et al. 2001)
pBAD33 / (CmR); p15; araC pBAD / (Guzman et al. 1995)
pBAD-csrA3xFLAG / pBAD33; pBAD::csrA3xFLAG / This study
pBRplac / (AmpR); Plac promoter based expression vector with AatII at transcription start site / (Guillier and Gottesman 2006)
pBR-McaS / (AmpR); pBRplac with mcaScloned into AatII and HindIII / (Thomason et al. 2012)
pBR-McaS-2 / mutant A14U G15C A16U mcaS cloned into pBRplac / (Thomason et al. 2012)
pBR-McaS-3 / mutant A33U C34G G35A mcaS cloned into pBRplac / (Thomason et al. 2012)
pBR-McaS-4 / mutant G70C G71C A72U mcaS cloned into pBRplac / (Thomason et al. 2012)
pBR-McaS-8 / mutant A14U mcaScloned into pBRplac / This study
pBR-McaS-9 / mutant A33U C34G G35A A39U mcaScloned into pBRplac / This study
pBR-McaS-10 / mutant A14U A33U C34G G35A mcaScloned into pBRplac / This study
pBR-McaS-11 / mutant A39U mcaScloned into pBRplac / This study
pBR-McaS-12 / mutant A14U A33U C34G G35A G70C G71C A72TmcaS cloned into pBRplac / This study
pBR-McaS-13 / mutant A14U G24T G25C A26T A33U C34G G35A mcaS cloned into pBRplac / This study
pBR-CsrB / (AmpR); pBRplac with csrB cloned into AatII and EcoRI / (Mandin and Gottesman 2010)
pBR-GcvB / (AmpR); pBRplac with gcvB cloned into AatII and EcoRI / (Mandin and Gottesman 2010)
Supplemental Table S2. Oligonucleotides used in this study.
Number / Name / Sequence / Use
McaS_NB / McaS probe / TCCGCGTCTTAAATCCGGCATTGTCTCCTCTGCGCCGGT / McaS Northern probe
RprA_NB / RprA probe / GCCCATCGTGGGAGATGGGCAAAGACTACACACAG / RprA Northern probe
CsrB_NB / CsrB probe / CATCCTGGTGTGTCCTGCAGAAGTGTCATCATCCTG / CsrB Northern probe
GcvB_NB / GcvB probe / GCAATTAGGCGGTGCTACATTAATCACTATGGACAG / GcvB Northern probe
OmrA NB / OmrA probe / GTGCAAGAGACAGGGTACGAAGAGCGTACCGA / OmrA Northern probe
CsrC NB / CsrC probe / TCCTGAGTCATTGTTCCTGTTAGCGTCCTCG / CsrC Northern probe
MK0063 / McaS probe / AGCAGTGCATCCGCGTCTTAAATCC / McaS Northern probe
MK0018 / McaS probe / CCAGACTCTACAGTACACACAGCAG / McaS mutants Northern probe
5S / 5S probe / CGGCGCTACGGCGTTTCACTTCTG / 5S Northern probe
5S_NB / 5S probe / CTACGGCGTTTCACTTCTGAGTTCCCGTATGTAGCATCACCTTC / 5S Northern probe
MK0318 / CsrB probe / CTGCGTCATCCTCTTCGCTTCATCCAGAAGC / CsrB Northern probe
MK0475 / CsrC probe / GACCCTCATCCTGAGTCATTGTTCCTG / CsrC Northern probe
For in vitro transcription of various RNAs
T7_mcaS / McaS primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGAGACAA / In vitro transcription forward primer for McaS
T7_mcaS2 / McaS-2 primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGTCTCAATGCCGGATTTAAGACGCGGATGCACTGCTGTG / In vitro transcription forward primer for McaS-2
T7_mcaS3 / McaS-3 primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGAGACAATGCCGGATTTAAGTGACGGATGCACTGCTGTG / In vitro transcription forward primer for McaS-3
T7_mcaS8 / McaS-8 primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGTGACAATGCCGGATTTAAGACGCGGATGCACTGCTGTG / In vitro transcription forward primer for McaS-8
T7_mcaS9 / McaS-9 primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGAGACAATGCCGGATTTAAGTGACGGTTGCACTGCTGTGTGTAC / In vitro transcription forward primer for McaS-9
T7_mcaS10 / McaS-10 primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGTGACAATGCCGGATTTAAGTGACGGATGCACTGCTGTG / In vitro transcription forward primer for McaS-10
T7_mcaS11 / McaS-11 primer with T7 site / GAAATTAATACGACTCACTATAGGACCGGCGCAGAGGAGACAATGCCGGATTTAAGACGCGGTTGCACTGCTGTGTGTAC / In vitro transcription forward primer for McaS-11
Bam_mcaS_R / Common McaS Rev primer / ccccGGATCCAAAAAATAGAGTCTGTCGACATCCGCCAGACTCTACAGTAC / Common McaS reverse primer for in vitro transcription and cloning into pNDM-220
T7_RprA / RprA primer with T7 site / GAAATTAATACGACTCACTATAGGACGGTTATAAATCAACATATTGATTTATA / In vitro transcription forward primer for RprA
RprA_R / RprA rev primer / AAAAAAAGCCCATCGTGGGAGATG / RprA reverse primer for in vitro transcription
T7-GcvB / GcvB primer with T7 site / GAAATTAATACGACTCACTATAGGACTTCCTGAGCCGGAACGAAAAG / In vitro transcription forward primer for GcvB
GcvB_R / GcvB rev primer / AAAAAAGGTAGCTTTGCTACCATGGTC / GcvB reverse primer for in vitro transcription
T7_CsrB / CsrB primer with T7 site / GAAATTAATACGACTCACTATAGGaGTCGACAGGGAGTCAGACAACGAAGTGAAC / In vitro transcription forward primer for CsrB
CsrB_R / CsrB rev primer / AATAAAAAAAGGGAGCACTGTATTCACAGCGCTCCCGGT / CsrB reverse primer for in vitro transcription
T7_CsrC_F / CsrC primer with T7 site / GAAATTAATACGACTCACTATAGGATAGAGCGAGGACGCTAACAGGAACAATGA / In vitro transcription forward primer for CsrC
T7_CsrC_R / CsrC rev primer / AAGAAAAAAGGCGACAGATTACTCTGTCGCCTTTTTTCCTGACTC / CsrC reverse primer for in vitro transcription
For cloning McaS (and mutant versions) and CsrA into plasmids
pA1/O4_mcaS3 / pNDM-McaSmut3 fwd primer / GCCTGACGTCGGCAAAAAGAGTGTTGACTTGTGAGCGGATAACAATGATACTTAGATTCACCGGCGCAGAGGAGACAATGCCGGATTTAAGTGACGGATGCACTGCTGTG / Forward primer for McaS-3 cloning into pNDM-220
pA/O4_mcaS8 / pNDM-McaSmut8 fwd primer / GCCTGACGTCGGCAAAAAGAGTGTTGACTTGTGAGCGGATAACAATGATACTTAGATTCACCGGCGCAGAGGTG / Forward primer for McaS-8 cloning into pNDM-220
Pst_SD_csrA / pBAD33 cloning CsrA fwd / CCCCCTGCAGTCGATTAAGGAGGTCACATATGCTGATTCTGACTCGTCGAGT / Forward primer for amplifying CsrA3FLAG for cloning into pBAD33
Hind_FLAG_R / pBAD33 cloning CsrA rev / GGGGCTGCAGTTACTATTTATCGTCGTCTCTTTG / Reverse primer for amplifying CsrA3FLAG for cloning into pBAD33
MK0099 / pBRplac fwd primer / GCGACACGGAAATGTTGAATAC / Forward primer for PCR and sequencing check for cloning into pBRplac
MK0100 / pBRplac rev primer / CAGTACCGGCATAACCAAGC / Reverse primer for PCR and sequencing check for cloning into pBRplac
MK0098 / McaS-pBR-fwd-aatII / TATACTATGACGTCTCACCGGCGCAGAGGAGACAATG / Common forward primer for PCR of McaS, 5' AatII restriction site for cloning, use in PCR #3 for mutant construction with PCR #1, #2 as templates
MK0065 / McaS-rev-hindIII / GACCGGAAGCTTGAATGCGGCTATCTGCAAAG / Common reverse primer for PCR of McaS, 3' HindIII restriction site for cloning, use in PCR #3 for mutant construction with PCR #1, #2 as templates
MK0096 / McaS rev PCR #1 / GTTCTCAGCCTGTATCAGTCT / Common reverse primer for McaS mutant cloning PCR #1
MK0064 / McaS fwd PCR #2 / GCCACTGAATTCGAAATCTGTCACTGAAGAAAAT / Common forward primer for McaS mutant cloning PCR #2
MK0443 / McaS-8, McaS-10, McaS-12, McaS-13 fwd aatII / tatactatgacgtcACCGGCGCAGAGGTGACAATGCCGGATTTAAG / Forward primer for McaS-8, McaS-10, McaS-12, and McaS-13 mutants, aatII site for cloning, use with MK0065 for mutant construction
MK0444 / McaS-9 fwd PCR #1 / CCGGATTTAAGTGACGGTTGCACTGCTGTGTG / Forward primer for McaS-9 mutant PCR #1; use with MK0096
MK0445 / McaS-9 rev PCR #2 / CACACAGCAGTGCAACCGTCACTTAAATCCGG / Reverse primer for McaS-9 mutant PCR #2, 5' end complimentary to MK0444; use with MK0064
MK0243 / McaS-3, McaS-10, McaS-12 fwd PCR #1 / CCGGATTTAAGTGACGGATGCACTG / Forward primer for McaS-3, McaS-10, and McaS-12 mutants PCR #1; use with MK0096
MK0244 / McaS-3, McaS-10 rev PCR #2 / CTTAAATCCGGCATTGTCTCC / Reverse primer for McaS-3, and McaS-10 mutant PCR #2, 5' end complimentary to MK0243; use with MK0064
MK0465 / McaS-11 fwd PCR #1 / CCGGATTTAAGACGCGGTTGCACTGCTGTGTG / Forward primer for McaS-11 mutant PCR #1; use with MK0096
MK0466 / McaS-11 rev PCR #2 / CACACAGCAGTGCAACCGCGTCTTAAATCCGG / Reverse primer for McaS-11 mutant PCR #2; 5' end complimentary to MK0465; use with MK0064
MK0483 / McaS-12 rev PCR #2 / GTCGACAAGGGCCAGACTCTACAGTACACACAGCAGTGCATCCGTCACTTAAATCC / Reverse primer for McaS-12 mutant PCR #2; 5’ end complimentary to MK0243; use with MK0064
MK0484 / McaS-13 fwd PCR #1 / CAATGCCTCTTTTAAGTGACGGATGCACTGC / Forward primer for McaS-13 mutant PCR #1; use with MK0096
MK0485 / McaS-13 rev PCR #2 / GCAGTGCATCCGTCACTTAAAAGAGGCATTG / Reverse primer for McaS-13 mutant PCR #2; 5’ end complimentary to MK0484; use with MK0064
Primers to create gene knockouts
pgaA_del_F / pgaA::kan knockout fwd / AAAAATCCGAAATCATGCATCGGAATTTACTGATTTAATTATTTTAATCCtgtgtaggctggagctgcttc / Forward primer for pgaA knockout PCR using pKD4 as template
pgaA_del_R / pgaA::kan knockout rev / GCGGCAGCAAGTTGATTATTACGTAATGCCTGCACGTATTCTGTGGGATAcatatgaatatcctccttag / Reverse primer for pgaA knockout PCR using pKD4 as template
MK0237 / pgaA::cat knockout fwd / ATACAGAGAGAGATTTTGGCAATACATGGAGTAATACAGGgtgtaggctggagctgcttc / Forward primer for pgaA knockout PCR using pKD3 as template
MK0464 / pgaA::cat knockout rev / ATCAGGAGATATTTATTTCCATTACGTAACATATTTATCCcatatgaatatcctccttag / Reverse primer for pgaA knockout PCR using pKD3 as template
MK0239 / pgaA check fwd / TCCGAAATCATGCATCGGAATTTAC / Forward primer for pgaA knockout PCR check and sequencing
MK0240 / pgaA check rev / CACGGTTGCTCGGCGAGTAA / Reverse primer for pgaA knockout PCR check and sequencing
csrA3FLAG_F / csrA FLAG tag fwd / GGAAGTTTCTGTTCACCGTGAAGAGATCTACCAGCGTATCCAGGCTGAAAAATCCCAGCAGTCCAGTTACGACTACAAAGACCATGACGGTGATTATAAA / Forward primer used for chromosomal csrA-FLAGtagged amplification
csrA3FLAG_R / csrA FLAG tag rev / AGTAAAGCGAAAAGACAATGGAGTGAAAGAGAAATTTTGAGGGTGCGTCTCACCGATAAAGATGAGACGCCATATGAATATCCTCCTTAG / Reverse primer used for chromosomal csrA-FLAG tagged amplification
Primers to create lacZ fusions
MK0174 / PBAD-fwd / CGACGAATTCGCGCTTCAGCCATACTTTTCATAC / General forward primer for checkingPBAD-lacZ fusion integration and sequence
MK0175 / Deeplac rev / CGGGCCTCTTCGCTA / General reverse primer for checking PBAD-lacZfusion integration and sequence
MK0242 / pgaA-lacZ rev / TAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACCGGGCACCTTTTTCTGCT / Common reverse primer for pgaA-lacZ fusion generation
MK0314 / pgaA155-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATGACACTCTGCTCATCATTTC / Forward primer for pgaA155-lacZ truncation fusion generation; use with MK0242
MK0395 / pgaA108-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATTCTCTTCCGCGTTTAATAAC / Forward primer for pgaA108-lacZ truncation fusion generation; use with MK0242
MK0396 / pgaA67-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATTCTTTCTTTTCAGTTACCTG / Forward primer for pgaA67-lacZ truncation fusion generation; use with MK0242
MK0436 / pgaA30-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATAGATTTTGGCAATACATGGA / Forward primer for pgaA30-lacZ truncation fusion generation; use with MK0242
MK0448 / ydaM-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATGAATTATCTGATCATATGAC / Forward primer for ydaM-lacZ fusion generation; use with MK0450
MK0450 / ydaM-lacZ Rev / TAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGTCCAGGGTATTGAAGTTGT / Reverse primer for ydaM-lacZ fusion generation; use with MK0448
MK0451 / ycdT-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATAAAGGGATCTACAACCTACA / Forward primer for ycdT-lacZ fusion generation; use with MK0452
MK0452 / ycdT-lacZ rev / TAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACACTACTAATTCTCAAAT / Reverse primer for ycdT-lacZ fusion generation; use with MK0451
MK0453 / ydeH-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATGCACAAGGAACTGTGAAAA / Forward primer for ydeH-lacZ fusion generation; use with MK0454
MK0454 / ydeH-lacZ rev / TAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCATCAATTTCCGTTG / Reverse primer for ydeH-lacZ fusion generation; use with MK0453
MK0315 / glgC-lacZ fwd / ACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATTGCTCAACCTTTAAGCACGG / Forward primer for glgC-lacZ fusion generation; use with MK0317
MK0317 / glgC-lacZ rev / TAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACTAAGTGATCGTTCTTCTCTA / Reverse primer for glgC-lacZ fusion generation; use with MK0315
Primers to integrate McaS-3, McaS-8 onto the chromosome
MK0202 / McaS-cat-sacB fwd / CTGTCACTGAAGAAAATTGGCAACTAAAGGTTAAAACCGTatcggcaatttcttttgcgttt / Forward primer for amplification of cat-sacB with region of mcaShomology for integration; use with MK0203
MK0203 / McaS-cat-sacB rev / TCTTAAATCCGGCATTGTCTCCTCTGCGCCGGTGACTGTaaaatgagacgttgatcggcacg / Reverse primer for amplification of cat-sacB with region of mcaShomology for integration; use with MK0202
MK0204 / McaS cat-sacB PCR check fwd / CCCGCAATTAAGAGCGCGAT / Forward primer to PCR check integration of cat-sacB and mcaS-3, mcaS-8 chromosomal mutations
MK0205 / McaS cat-sacB PCR check rev / GAATGCGGCTATCTGCAAAG / Reverse primer to PCR check integration of mcaS-3, mcaS-8 chromosomal mutations
MK0468 / McaS-3 chrom fwd PCR #1 / GCAGTGCATCCGTCACTTAAATCCGGCAT / Forward primer for McaS-3 integration on chromosome; use with MK0160 in PCR #1
MK0160 / McaS chrom rev common primer PCR #1 / GAAACTATCCGCGTAAGCGTGGC / Common reverse primer for mcaSintegration on chromosome; use with MK0468 in PCR #1 formcaS-3, use with MK0472 in PCR #1 for mcaS-8
MK0467 / McaS-3 chrom fwd PCR #2 / ACCGGCGCAGAGGAGACAATGCCGGATTTAAGTGACGGATGCACTGCTGTGTGTACTGTA / Forward primer for mcaS-3 integration on chromosome; use with MK0159 in PCR #2
MK0159 / McaS chrom rev common primer PCR #2 / TCACGTCGCCAGTGCGATAAT / Common reverse primer for McaS integration on chromosome; use with MK0467 in PCR #2 for mcaS-3, use with MK0471 in PCR #2 for mcaS-8
MK0472 / McaS-8 chrom fwd PCR #1 / CGTCTTAAATCCGGCATTGTCACCTCTGCGCCGGT / Forward primer for mcaS-8integration on chromosome; use with MK0160 in PCR #1
MK0471 / McaS-8 chrom fwd PCR #2 / ACCGGCGCAGAGGTGACAATGCCGGATTTAAGACG / Forward primer for mcaS-8integration on chromosome; use with MK0159 in PCR #2
MK0469 / McaS chrom common fwd PCR #3 / CCTGAAGAAATGGGCTGCGATCCCTTGCAC / Forward primer for mcaSintegration on chromosome; use with MK0470 for PCR #3 for both mcaS-3 and mcaS-8 integration on chromosome
MK0470 / McaS chrom common rev PCR #3 / TGGATGCCAGTGGACATCGGTAGC / Reverse primer for mcaSintegration on chromosome; use with MK0469 for PCR #3 for both mcaS-3 and mcaS-8 integration on chromosome

Supplemental Methods