Cephalopod Eye Evolution Was Modulated by the Acquisition of Pax-6 Splicing Variants

Cephalopod eye evolution was modulated by the acquisition of Pax-6 splicing variants

Masa-aki Yoshida1, Kei Yura2,3, Atsushi Ogura4,*

1Research fellow of the Japan Society for the Promotion of Science, National Institute of Genetics, 1111 Yata, Mishima, Shizuoka 411-8540, Japan, 2Computational Biology, Graduate School of Humanities and Sciences, 3Center for Informational Biology, Ochanomizu University, 2-1-1 Otsuka, Bunkyo, Tokyo 112-8610, Japan, 4Nagahama Institute of Bio-Science and Technology, 1266 Tamura, Nagahama, 526-0829, Japan.

*Corresponding Author:Atsushi Ogura, E-mail:

Figure legends

Supplementary figure 1 Phylogenetic tree of animal Pax gene family by the ML method based on full-length amino acid sequences. Alignment of the protein sequences was obtained using the clustalw2. Monophyletic relationship in the tree shows that the pygmy squid Pax-6 determined in this study (IpPax-6) is an ortholog of animal Pax-4/6 genes. Numbers in bracket indicate the accession numbers of the Pax proteins used in the tree analysis. The bootstrap probabilities are shown at each branch.

Supplementary figure 2 RT-PCR indicates differential splicing across pygmy squid embryonic stages. RT-PCR using primers targeting exons 2 and 7 shows spatio-temporal expression patterns of all five splicing variants (A). To show temporal difference of variants 2 and 3, we used a primer targeting boundary exon 2 and 4 (B). The 668bp cDNA for IpPax-6 variant 4 was found exclusively in the squid eye (A). Variant 1 (458bp) was under-regulated in the adult tissue (A), but expressed across embryonic stages used in this study. The variants 2 and 3 were also expressed across embryonic stages (B).

Figure S1

Figure S2

Table S1 Primers used in RT-PCR and RACE cloning

Name / Target exon / Strand / Sequence
IpPax-6_3RACE / forward / GCAAGATTCTCGGACGCTACTATGA
IpPax-6_5RACE / reverse / CATGGAGGCATTAGGGGCGTACCAG
IpPax-6 new exon f
(IpPax-6 deletion f) / exon 2 / forward / CAACCAAACCCACCTTCAACC
IpPax-6 new exon r / exon 4 / reverse / GGATAATGAGTGCGTTCAAATTC
IpPax-6 deletion r / exon 7 / reverse / AAACGGGCGAGTCCTTCCTTG
Pax variant squid F1 / exon 2 of L. bleekeri / forward / CAACCAAACCCACCTTCAACC
Pax variant squid R1 / (exon 4 of L. bleekeri) / reverse / CCCCTGACCGTTGTCCGAACTG
Pax variant squid F2 / exon 5 of L. bleekeri / forward / AATGCTTCCTCRTAYTCRTGTATG
Pax variant squid R2 / exon 7 of L. bleekeri / reverse / GGRTCGTAGCTTCTTGCTGTTCC

Table S2 Primers used in Realtime PCR

Name / Target exon / Strand / Sequence
IpPax-6 general f / exon 2 / forward / ATATTCGCATGGGAAATTGG
IpPax-6 general f / exon 2 / reverse / ACGAAGCACCCTGTTTATCG
deletion target f / boundary of exons 2 and 5 / forward / TGGCCGGCAAAAAGAATTTG
deletion target r / exon 5 / reverse / TTTTCTGAGCTAACCTCTCTCG
insertion target f / exon 6 / forward / TCTAATGGAATCTTCGCGTGC
insertion target r / exon 6 / reverse / CTAAGGGACAGACCATCGTAGC
RT alpha tublin f / forward / AAGATTTGGCTGCGCTAGAG
RT alpha tublin r / reverse / CTTCGCCTTCTTCCTCTTCC

Table S3 Primers used for RNA probe construction

Name / Target exon / Strand / Sequence
Pax300 f / exon 2 / forward / TGGGAGGTGTATTCGTTAATGG
Pax300 r / exon 2 / reverse / AGTGCAAACTCCTTCTGACAGCAAT
Pax probe del f / exon 2 / forward / CCCCCTCGAGTTACACACAACCAAACCCAC
Pax probe del r / exon 5 / reverse / ACCTGTATACGGGCTTCGGGCA