Supplemental Materials and Methods

Yan_1

SUPPLEMENTAL MATERIALS AND METHODS

Plasmids, Antibodies, and Reagents

The cDNAs for wild-type or deletion mutants of JFK were amplified by PCR and ligated into XbaI/EcoRI sites of a pcDNA3.1 vector that contains one or three copies of FLAG. The GST-JFK, GST-JFKDF-box, or GST-JFKDKelch expression plasmid was constructed by cloning full-length or mutants of JFK into a pGEX-4T-3 vector. All clones were confirmed by DNA sequencing. pCMV-(HA-Ub)4, pcDNA3-Myc3-Fbw7, pcDNA3-Myc3-Skp2, pcDNA3-Myc3-mbTrcp, pcDNA3-HA2-Roc1, and pcDNA3-hSkp1 were from Dr. Yue Xiong (University of North Carolina, USA). pcDNA3.1-Myc-ING4 was from Dr. Jacques Cote (Laval University, Canada). ING4 deletion mutants were prepared by separate fragments of ING4, and ING4 point mutants and JFK were generated with Stratagene mutagenesis kit. The sources of antibodies were: anti-FLAG, anti-tubulin, anti-b-actin, anti-fibronectin, and anti-vimentin (Sigma); anti-ING4 (goat) (Santa Cruz); anti-HA, anti-Myc, anti-GAPDH, and anti-multi-ubiquitination (MBL); anti-E-cadherin (rabbit), anti-a-catenin, anti-b-catenin, anti-g-catenin (rabbit), anti-N-cadherin, anti-Cul1, and anti-p65 (Cell Signaling Technology); anti-ING4 (mouse), anti-p100, anti-Cyclin E (Abcam); anti-E-cadherin (mouse), anti-SM actin, and anti-g-catenin (mouse) (BD Bioscience); anti-Skp1 and anti-Rbx1 (Zymed Laboratories); anti-IL-8 (Bioworld); anti-CD31, and anti-MMP9 (Abclonal). Polyclonal antibodies against JFK were raised against the C-terminal epitope of the JFK protein (CYPKTNALYFVRAKR) in rabbits.

Cell Culture and Transfection

Cells were maintained according to the ATCC’s recommendation. All transfections were carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations. The sequences of siRNAs were: JFK siRNA-1, 5’-CAGACAAAUGGUGUGCAUA-3’; JFK siRNA-2, 5’-GACUUGACCUAAACAGCAA-3’; JFK siRNA-3, 5’-GGUGUAGCCCAUCAGUGUU-3’; ING4 siRNA-1, 5’- ACUGCCCAGAAGAAGUUAAA-3’; ING4 siRNA-2, 5’- GCCACUGAGUAUAUGAGUA-3’; ING4 siRNA-3, 5’-GUGCGCACAAGUCCUGAGUAU-3’; and control siRNA, 5’-UUCUCCGAACGUGUCACGU-3’. All of the siRNAs were synthesized by GeneChem Inc. (Shanghai, China). siRNA oligonucleotides were transfected into cells using RNAiMAX (Invitrogen) with the final concentration at 20 nM.

Immunopurification, Silver Staining, and Mass Spectrometry

MCF-7 cells were transfected with FLAG-ING4 for forty-eight hours, and treated with MG132 (Sigma) for 6 h before harvest. Cellular lysates were prepared by incubating the cells in lysis buffer containing protease inhibitor cocktail (Roche). Anti-FLAG immunoaffinity columns were prepared using anti-FLAG M2 affinity gel (Sigma) following the manufacturer’s suggestions. Cell lysates were obtained from about 5 × 108 cells and applied to an equilibrated FLAG column of 1-ml bed volume to allow for adsorption of the protein complex to the column resin. After binding, the column was washed with cold PBS plus 0.1% Nonidet P-40. FLAG peptide (Sigma) was applied to the column to elute the FLAG protein complex as described by the vendor. Fractions of the bed volume were collected and resolved on NuPAGE 4-12% Bis-Tris gel (Invitrogen), silver stained using Pierce silver stain kit, and subjected to LC-MS/MS (Agilent 6340) sequencing.

Fast Protein Liquid Chromatography

MCF-7 cells were transfected with FLAG-ING4 for forty-eight hours, and treated with MG132 (Sigma) for 6 h before harvest. Cellular lysates were prepared by incubating the cells in lysis buffer containing protease inhibitor cocktail (Roche). Anti-FLAG immunoaffinity columns were prepared using anti-FLAG M2 affinity gel (Sigma) following the manufacturer’s suggestions. Cell lysates were obtained and applied to an equilibrated FLAG column of 1-ml bed volume to allow for adsorption of the protein complex to the column resin. After binding, the column was washed with cold PBS plus 0.1% Nonidet P-40. FLAG peptide (Sigma) was applied to the column to elute the FLAG protein complex as described by the vendor. Fractions of the bed volume were collected and concentrated to 0.5 ml using a Millipore Ultrafree centrifugal filter apparatus (3 kDa nominal molecular mass limit), and then applied to an 850 × 20 mm Superose 6 size exclusion column (Amersham Biosciences) that was equilibrated with PBS and calibrated with protein standards (blue dextran, 2000 kDa; thyroglobulin, 669 kDa; ferritin, 440 kDa; aldolase, 158 kDa; ovalbumin, 43 kDa; all from Amersham Biosciences). The column was eluted at a flow rate of 0.5 ml/min and fractions were separately collected.

Co-immunoprecipitation and Western blotting

Co-immunoprecipitation and western blotting were performed according to the procedure described previously (Wang et al. 2009). Briefly, MCF-7 cellular lysates were prepared by incubating the cells in lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40, 2 mM EDTA) containing protease inhibitor cocktail (Roche) for 20 min at 4°C, followed by centrifugation at 14,000 g for 15 min at 4°C. The protein concentration of the lysates was determined using the BCA protein assay kit (Pierce) according to the manufacturer's protocol. For immunoprecipitation, 500 mg of protein was incubated with 1-2 mg specific antibodies for 12 h at 4ºC with constant rotation; 60 ml of 50% protein A or G agarose beads was then added and the incubation was continued for an additional 2 h. Beads were then washed five times using the lysis buffer. Between washes, the beads were collected by centrifugation at 500 g for 5 min at 4ºC. The precipitated proteins were eluted from the beads by resuspending the beads in 2 × SDS-PAGE loading buffer and boiling for 5 min. The resultant materials from immunoprecipitation or cell lysates were resolved using 10% SDS-PAGE gels and transferred onto nitrocellulose membranes. For western blotting, membranes were incubated with appropriate antibodies for 1 h at room temperature or overnight at 4ºC followed by incubation with a secondary antibody. Immunoreactive bands were visualized using Western blotting Luminol reagent (Santa Cruz) according to the manufacturer’s recommendation.

GST Pull-down Assay

GST fusion constructs were expressed in BL21 E. coli bacteria, and crude bacterial lysates were prepared by sonication in TEDGN (50 mM Tris-HCl, pH 7.4, 1.5 mM EDTA, 1 mM dithiothreitol, 10% (v/v) glycerol, 0.4 M NaCl) in the presence of the protease inhibitor mixture. In vitro transcription and translation experiments were done with rabbit reticulocyte lysate (TNT systems, Promega) according to the manufacturer’s recommendation. GST pull-down assays were performed as described previously (Wang et al. 2009). Briefly, equal amounts of GST fusion proteins were immobilized on 50 ml of 50% glutathione-Sepharose 4B slurry beads (Amersham Biosciences) in 0.5 ml of GST pull-down binding buffer (10 mM HEPES, pH 7.6, 3 mM MgCl2, 100 mM KCl, 5 mM EDTA, 5% glycerol, 0.5% CA630). After incubation for 1 h at 4°C with rotation, beads were washed three times with GST pull-down binding buffer and resuspended in 0.5 ml of GST pull-down binding buffer before adding 10 ml of in vitro transcribed/translated proteins for 2 h at 4°C with rotation. The beads were then washed three times with binding buffer. The bound proteins were eluted by boiling in 30 ml of 2 × sample loading buffer and resolved on SDS-PAGE.

Ubiquitination Assay

For in vivo ubiquitination assays, cells were transfected with the indicated plasmids, and treated with 5 mM MG132 (Sigma) for 12 h before harvest. As previously described (Didier et al. 2003), cells were lysed in 2% SDS buffer containing 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, and protease inhibitor (Roche), and boiled for 10 min followed by sonication for 2 min. Lysates were diluted 1:10 in dilution buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 2 mM EDTA and 1% Triton X-100), incubated at 4°C for 30-60 min with rotation, and centrifuged at 20,000 g for 30 min. For immunoprecipitation, 0.5-1.5 mg of cellular extracts was incubated with anti-Myc-conjugated protein G-Sepharose beads overnight. The beads were washed five times with washing buffer (10 mM Tris-HCl, pH 8.0, 1 M NaCl, 1 mM EDTA and 1% NP-40), boiled in SDS sample buffer and subjected to SDS-PAGE followed by immunoblotting. For in vitro ubiquitination assay, the Ubiquitin Conjugation kit (Boston Biochem) was used. Conjugation Fraction A contains predominantly E1 and E2 enzymes, and Conjugation Fraction B contains predominantly E3 and deubiquitinating enzymes. Briefly, 3 mg of GST fusion proteins (GST-JFK, GST-JFKDKelch, or GST-JFKDF-box) were immobilized on 50 ml of 50% glutathione-Sepharose 4B slurry beads (Amersham Biosciences) in 0.5 ml of GST pull-down binding buffer (10 mM HEPES, pH 7.6, 3 mM MgCl2, 100 mM KCl, 5 mM EDTA, 5% glycerol, 0.5% CA630). After incubation for 1 h at 4°C with rotation, beads were washed three times with GST pull-down binding buffer and resuspended in 0.5 ml of GST pull-down binding buffer before adding 10 ml of in vitro transcribed/translated wild-type ING4 or point mutants of ING4 for 2 h at 4°C with rotation. The beads were washed three times with binding buffer, and incubated with 8 mg of fraction A, 8 mg of fraction B, 26 mg of ubiquitin, 4 mM ubiquitin aldehyde, and 2.5 ml of energy solution (10 ×) in a 25 ml volume. After incubation at 37°C for 30 min, the beads were washed three times with binding buffer, and boiled in SDS sample buffer and subjected to SDS-PAGE followed by immunoblotting.

PCR Array

MCF-7 cells were transfected with empty vector or JFK, or treated with control siRNA or ING4 siRNA. Total cellular RNAs were prepared, and RT2 First Strand kit (SuperArray Bioscience) was used for cDNA synthesis to profile ~100 key genes in 10 prominent cellular signal transduction pathways using Human Signal Transduction PathwayFinder PCR Array (SuperArray Bioscience). Data was calculated by means of the comparative Ct method (2-ΔΔCt) with the expression of GAPDH as an internal control.

Fluorescence Confocal Microscopy

Cells were plated into six-well chamber slides and were transfected with vector, JFK, or/and ING4. After transfection, cells were washed with PBS, fixed in 4% (w/v) paraformaldehyde, permeabilized with 0.1% (v/v) Triton X-100 in PBS, blocked with 0.8% BSA, and incubated with appropriate primary antibodies followed by staining with FITC or TRITC-conjugated secondary antibodies (Jackson ImmunoResearch). The cells were then washed four times and a final concentration of 0.1 μg/ml DAPI (Sigma) was included in the final wash to stain nuclei. Images were visualized with an Olympus inverted microscope equipped with a charge-couple camera.

Real time Reverse Transcription PCR (qPCR)

Total cellular RNAs were isolated from samples with Trizol reagent (Invitrogen). Any potential DNA contamination was removed by RNase-free DNase treatment (Promega). First strand cDNA were synthesized with the Reverse Transcription System (Promega, A3500). Quantitation of all gene transcripts was done by qPCR using Power SYBR Green PCR Master Mix and an ABI PRISM 7500 sequence detection system (Applied Biosystems, Foster City, CA) with the expression of GAPDH as the internal control. The primers used were ING4: ATGGCTGCGGGGATGTATTTGGAAC (forward) and CTATTTCTTCTTCCGTTCTTGGGAGCAG (reverse); GAPDH: GAAGGTGAAGGTCGGAGTC (forward) and GAAGATGGTGATGGGATTTC (reverse); IL-6: CCAGCTATGAACTCCTTCTC (forward) and GCTTGTTCCTCACTACTCTC (reverse); IL-8: AGGTGCAGTTTTGCCAAGGA (forward) and TTTCTGTGTTGGCGCAGTGT (reverse); VCAM1: GCTGCTCAGATTGGAGACTCA (forward) and CGCTCAGAGGGCTGTCTATC (reverse); ICAM1: CTGTGTCCCCCTCAAAAGTC (forward) and GGGGTCTCTATGCCCAACAA (reverse); MMP9: CCTGGAGACCTGAGAACCAATC (forward) and CACCCGAGTGTAACCATAGC (reverse); CCL5: CCCTCGCTGTCATCCTCATTG (forward) and ACACACTTGGCGGTTCTTTCG (reverse); STAT1: TGTATGCCATCCTCGAGAGC (forward) and CGTGCTCCCAGTCTTGCTTT (reverse).

Retroviral and Lentiviral Production and Infection

The generation of the pBABE-JFK, JFKDF-box, JFKDKelch or ING4-integrated retroviruses was conducted according to a protocol described by Weinberg’s lab (Addgene: production of retroviruses using FuGENE-6). Briefly, the human expression plasmid of pBABE-JFK, JFKDF-box, JFKDKelch, or ING4 was generated by subcloning the JFK, JFKDF-box, JFKDKelch, or ING4 fragment into the pBABE-Puro vector. The retroviral plasmid vector, pBABE-JFK, pBABE-JFKDF-box, pBABE-JFKDKelch, or pBABE-ING4, together with pVSV-G and pGag-Pol were co-transfected into the packaging cell line 293T. Viral supernatants were collected 48 h later, clarified by filtration, and concentrated by ultracentrifugation. Lentiviruses carrying control siRNA, JFK siRNA, or ING4 siRNA were purchased from Cyagen Biosciences Inc. The concentrated virus was used to infect 5 × 105 cells (20-30% confluent) in a 60-mm dish with 8 mg/ml polybrene. Infected cells were selected by 2 mg/ml puromycin (Merck).

Endothelial Tube Formation Assay

Angiogenesis in vitro was assessed using the endothelial tube formation assay kit (Cell Biolabs, San Diego, CA). Each well of pre-chilled 24-well cell culture plates was coated with a thin layer of extracellular matrix gel prepared from Engelbreth-Holm-Swarm tumor cells (200 ml/well), which was left to polymerize at 37°C for 1 h. HUVECs (1 × 105 cells/well) infected with retroviruses carrying vector or JFK, or lentiviruses carrying control siRNA or JFK siRNA, or cultured with CM from MCF-7 cells that were infected with retroviruses carrying vector or JFK, or lentiviruses carrying control siRNA or JFK siRNA were added onto solidified extracellular matrix gel in 600 ml medium. After 8-18 h of incubation, endothelial cell tube formation was assessed and tube number was counted under light microscopy.

Chicken Yolk Sac Membrane (YSM) Assay

Fertilized eggs were chosen and cracked on day 3 as described (Shing et al. 1985). On day 8, gelatin sponges were cut to a size of 1 mm3 and placed on top of the YSM under sterile conditions. They were then adsorbed with MCF-7 cell suspensions (about 1 × 106 cells/sponge) which were transfected with vector, JFK, or/and ING4, or treated with control siRNA or JFK siRNA. On day 12, the vessels of YSM were examined and counted.

Matrigel Plug Assay

The matrigel plug assay was performed as described (Angiolillo et al. 1995). Briefly, matrigels only (BD Biosciences, 0.5 ml) or matrigels that were mixed with MCF-7 cells (1 × 106) that were infected with retroviruses carrying empty vector, JFK or/and ING4, or lentiviruses carrying control siRNA, JFK siRNA, or ING4 siRNA were injected subcutaneously into the mid-abdominal region of 6-week-old BALB/c female mice (n = 6). After 7 days, the mice were sacrificed and the matrigel plugs were retrieved and fixed with 10% PFA, processed, and stained with H&E and Masson’s trichrome (Histoserve, MD). Animal handling and procedures were approved by the Peking University Health Science Center Institutional Animal Care and Use Committee (LA2014-2).

Vascular Imaging

MDA-MB-231-Luc-D3H2LN cells (MDA-MB-231 cell line engineered to stably express firefly luciferase) (Xenogen Corporation) were infected with retroviruses carrying vector or JFK. These cells were inoculated into the left abdominal mammary fat pad (2 × 106 cells) of 6-week-old immunocompromised female SCID beige mice (Charles River, Beijing, China). Images of tumor microvasculature were obtained by Vevo 2100 Imaging Platform (VisualSonics Inc.) with Power Doppler Mode 5 weeks after tumor onset. Relative density of vessels was measured by densitometry of the color pixels in Power Doppler images.

Transwell Invasion Assay

The transwell invasion assay was performed using the transwell chamber (Millipore) with a Matrigel-coated filter. MDA-MB-231 cells were cultured in Leibovitz's L-15 medium with 10% FCS at 37°C without CO2, and were infected with retroviruses carrying FLAG-tagged JFK, JFKDF-box, JFKDKelch, or/and ING4, or with lentiviruses carrying JFK siRNA or ING4 siRNA. After forty-eight hours, cells were deprived in serum-free Leibovitz's L-15 medium for 18 h, and harvested. These cells were washed three times in PBS and resuspended in serum-free culture medium. Afterwards, 1 × 105 of these cells in 300 ml of serum free media were plated onto the upper chamber of the transwell. The upper chamber was then transferred to a well containing 500 ml of media supplemented with 10% FCS and incubated for 24 h. Cells may actively migrate from the upper to the lower side of the filter due to FCS as attractant. Cells on the upside were removed using cotton swabs, and the invasive cells on the lower side were fixed, stained with 0.1% crystal violet solution, and counted using light microscope. The experiment was repeated three times.