The Amount If DNA in Each Human Cell Nucleus Is Approximately Four Billion Nucleotide Base Pairs

Detection of an Alu Polymorphism

by Polymerase Chain Reaction

As illustrated below, this exercise has four distinct steps. Since all four steps cannot be completed in one three hour session, the different steps will be completed over the course of several weeks. When working on any given step, it is a good idea to be aware of the overall exercise.

Step one

extract

cheek cellsStep 2

Isolate DNAStep 3

Amplify (PCR) DNA region

that may or may not have pv-92Step 4

electrophoresis to resolve

amplified regions, & analyze

Objectives

1. Reinforce concepts of exons, introns, and DNA synthesis

2. Gain an insight into what transposons are, and their number and significance in the human genome

3. Learn techniques important to and commonly used in biotechnology.

4. Each student is to determine the number of copies, if any, of a particular jumping gene he or she has.

Background Information

Each human chromosome is a very long double stranded DNA molecule, and contains millions of nucleotides (A’s, T’s, G’s and C’s). The pattern of these A’s, T’s, G’s and C’s form the complete human genome. It is currently estimated that the human genome has over 40,000 genes. While these genes code for the cellular activities that collectively result in a human being, a great part of human DNA, about 25%, belongs to a category called transposons.

Transposons, or jumping genes, have no apparent human related function, they appear to serve only to perpetuate themselves. There are a variety of different types of transposon (jump

ing genes) present in each human cell. The Alu family of transposons are only about 300 base pairs in length. When one is “activated”, it makes a copy of itself, and this copy is inserted randomly into one of the 46 chromosomes. As might be expected, the number of transposons per cell increases each time one is copied. Over millions of years, the number of Alu type transposons has grown to the extent that each human cell has over 2,000,000 copies (one million per haploid set of chromosomes). With so many copies, the Alu type of transposons amounts to approximately 10% of human DNA.

Exactly where in a chromosome a transposable element inserts itself could be of great consequence. To see how, one needs to know that most of the 40,000 plus human genes code for proteins. Whether a protein is an enzyme, a transport molecule, or has some other function, each protein contributes to some aspect of cell life. Most genes have exons (coding regions) and introns (non-coding regions), Promoters (region wher RNA polymerase attaches, and regulatory elements influence whether or not and the extent to which a gene is transcribed. The A’s, T’s, G’s and C’s within exons code for the amino acids that make up the functional protein. Any change in the coding region (exon) of a gene could be disastrous because the change might result in the production of a protein that does not function normally. Severe human diseases, such as mental retardation, immunodeficiencies, and cancer, are caused by changes in the coding regions of certain genes. Neurofibromatosis, a tumor disease, is an example of a human disease caused by the insertion of an Alu transposon into the coding region of a gene, the NF1 gene. In contrast, insertions into introns (non-coding regions of a gene) generally have no effect on a gene’s protein product.

Since there are so many transposons in every cell, and since insertions into exons can have serious consequences, it is often asked if transposons can have any benefits. One school of thought is that the many transposon copies increase the probability of molecular events where segments of DNA from different areas are exchanged. Because such exchanges can give rise to new genes and new gene combinations, is thought that transposons might be significant in evolution.

Alu-pv92 is the specific transposon that is the focus of this exercise. This insertion is found within an intron. Since the Alu-pv92 insertion occurs within an intron, the insertion has no effect on the production of this gene’s protein. While the Alu-pv92 insertion is wide spread in human populations throughout the world, its frequency is greater in certain parts of the world (see the website listed in the next paragraph). Nonetheless, it is expected that several students in each laboratory section will have one or two copies.

The web site

is very good. It explains what Alu transposons are, how they make copies of themselves, and how the copy inserts itself elsewhere.

First open the web site.

Click on the PV-92 insertions icon

Click on Continue on to Alu Insertion Polymorphisms

Then read over the text giving Alu stats, number of Alu copies per cell, what per cent of the human genome Alu occupies, how long Alu elements are, and type of transposon Alu is an example of.

Click on MEDIA/ANIMATION

Then click on “How Alu Jumps” to see the jumping mechanism.

What evidence is there that Alu transposons are “retrotransposons?”

The heart of this exercise is that you will use state-of-the-art biotechnology to determine how many, if any, copies of PV-92 you have.

You will first isolate your own DNA from a sample of your cheek cells.
You will then use PCR to make millions of copies of a targeted region (the region that may or may not have PV-92) of your genome.
Finally, you will use electrophoresis to resolve the DNA you made millions of copies of.

You will then use a powerful data base to determine:

What chromosome pv92 is located in
The name of the gene housing the intron carrying pv92
The name and function of the gene housing the intron

Polymerase Chain Reaction (PCR)

The web site mentioned above is also excellent for its PCR animations. This animation lets you see how PCR works, and helps reinforce the concepts of how DNA strands are held together, what primers are and do, and how DNA synthesis is accomplished.

Use the following address to go directly to the PCR animations

Click on MEDIA/ANIMATION

Then click on Polymerase Chain Reaction

Answer the following based on the website introduction

What is a primer, and what do they do?

What two innovations are important to PCR?

Next press “Menu” (lower left on the screen),

then click on “Amplification”

Try to answer the following questions as you proceed through the PCR animation. Be sure to ask your instructor if you can not figure out the answers.

What holds the DNA strands together?

Why is a high temperature required during denaturation?

What happens during the annealing step?

Why must the temperature be reduced during the annealing step?

What happens during the extend primers step?

Note that you can repeat a step many times. This is helpful to reinforce what is going on at a given step.

Press “Go to Second Cycle” and continue until you see the results of the fifth cycle.

When finished with the PCR animation, Click on the Menu(lower left on the screen). Then Click on Amplification Graph. Keep clicking on Next Cycle until you have 25 cycles.

How many copies of the targeted region are there after 25 cycles?

Please visit this web site and answer all of the questions before you go lab to do Step three (PCR to amplify DNA region that may or may not have PV-92)

Two very important facts regarding PCR are

1. primers determine the beginning and end of a specific segment DNA to be amplified

2. the number of DNA segments doubles after each cycle (separating DNA strands, primer binding, and extending the primer)

Using PCR to detect the presence of PV-92

So how does PCR allow one to determine if they have one, two, or no copies of the pv-92 transposon? First recall that pv-92 is located in an intron of chromosome #16, and that everyone has two chromosome #16’s (one contributed from their mother, and the other one contributed from their father at the time of conception).

In the following example both chromosome #16’s of an individual is shown. In this case, the intron of one of the person‘s #16 chromosomes has the pv-92 transpo

son, and the intron of this person’s other chromosome #16 does not have pv-92.

Arrows show where the primers used in PCR will bind. Primer one will determine the beginning, and primer two will determine the end of the intron region that PCR will make millions of copies of.

In this example case, PCR would make millions of copies that are 550 bases (does not have pv-92), and also millions of copies that are 850 bases (has pv-92). The next step would be to sort out and look at these two different sized pieces.

Determining PCR product size

It should be apparent from the two examples that the size of the amplified segment is used to determine the presence of the 300 base pv-92 transposon. If the amplified segment is 550 bases long, then it does not contain the transposon. However, if the amplified segment is 850 bases long, then the amplified segment contains the 300 base transposon. How then does one determine the size of the PCR product? The method used is called electrophoresis. First, DNA samples are loaded onto a gel, and electric current is applied. Because DNA is uniformly negatively charged, DNA is caused to migrate through the gel toward the positive electrode. Shorter molecules migrate faster then longer ones. Often DNA of known sizes (a ladder) is run in the same gel.

The following is an example of a gel run in a previous Bio 111 class. Samples were loaded in at the top.

A B C

Discuss the following with others at your table.

Which sample B or C contained DNA segments that were shorter?

Noting the band of the ladder that is 500 bases, approximately how big is the DNA of sample C?

How can you explain the two DNA bands of sample A?

Which band A, B, or C is homozygous without the transposon? Explain

Which band A, B, or C is homozygous with the transposon? Explain

Which band A, B, or C is heterozygous with transposon? Explain

Laboratory Procedure

Step one

extract

cheek cellsStep two

Isolate DNAStep three

Amplify (PCR) DNA region

that may or may not have pv-92Step four

electrophoresis to resolve

amplified regions, & analyze

Cheek Cell Extraction

Do not consume food or drink for at least 30 minutes prior to cheek cell extraction.

1. With a sterile cotton swab, gently scrape the inside of one cheek six times. Without rotating the swab, move the swab directly over to the inside of the other cheek and gently scrape six times.

2. Gently touch part of the swab containing your cheek cells on a clean glass slide once. Add a drop of methylene blue, then a cover slip. Examine using the high dry objective.

3. Insert the cotton portion of the swab into the mouth of a 1.5 ml microcentrifuge tube. The, using scissors or a pair of dikes, cut off the stick just above the cotton so that the cotton part falls into the tube. Close the lid, use a water insoluble ink to label your tube, and place the tube into the rack provided by your instructor. Your instructor will then place the tubes in the freezer (-20o) for storage.

4. Make a drawing of your cheek cells in the box provided below, be sure to

indicate the magnification.

Step two

Step one

extract

cheek cellsStep two

Isolate DNAStep three

Amplify (PCR) DNA region

that may or may not have pv-92Step four

electrophoresis to resolve

amplified regions, & analyze

DNA Isolation

1. Add 400 l of phosphate buffered saline (PBS) to the tube containing the cotton swab coated with your cheek cells.

2. Add 400 l of Qiagen buffer AL. This contains a detergent to aid in cell disruption, and to solubilize hydrophobic compounds.

3. Add 20 l of protease K solution. Close the lid and vortex immediately for 15 seconds. Immediate mixing is required to maximize cell lysis. This enzyme digests proteins, which will aid cells lysis, and in isolating the DNA.

4. Place your microcentrifuge tube in a heat block set to 56o, and incubate for ten minutes. Remove the tube and tap the tube on the counter to cause droplets, that may have condensed on the inside of the lid, to fall into the solution below.

5. Add 400 l of pure ethanol (190 –200 proof). Vortex for 15 seconds. This amount of ethanol will cause the DNA to precipitate but will leave the other compounds (proteins, carbohydrates, lipids, and salts) to remain in solution.

6. Remove 700 l and place into a QIAamp spin column that is seated in a 2 ml microfuge tube. Centrifuge at 8000 RPM for one minute. At this point the precipitated DNA is retained by the filter in the spin column, and the soluble compounds have been forced to the tube below.

Discard the tube containing the filtrate, and insert the spin column containing your DNA into a new 2 ml microfuge tube.

7. Add 500l Quiagen buffer AW1 without wetting the rim of the spin column. Centrifuge at 8,000 RPM for one minute. This, and the next step serve to wash the DNA. Since these wash solutions contain ethanol, the DNA remains precipitated and unable to pass through the filter in the spin column. Discard the tube containing the filtrate, and insert the spin column into a new 2 ml microfuge tube.

8. Add 500 l of Qiagen buffer AW2 without wetting the spin column rim. Centrifuge at 14,000 for 3 minutes. Complete removal of the AW2 buffer is necessary as its presence would prevent subsequent resolubilization of the DNA trapped in the spin column. Therefore, carefully remove the 2 ml microfuge tube to avoid splashing the filtrate back on to the spin column. Discard the microfuge tube containing the filtrate.

9. Insert the spin column into a sterile 1.5 ml microfuge tube. Add 150 l of AE buffer. This buffer has no ethanol and will bring the precipitated DNA back into solution. Incubate at room temperature for one full minute to give the DNA time to dissolve in the buffer.

10. Centrifuge at 8,000 RPM for one minute. The collection tube now contains your isolated DNA in solution. Label the tube with a water insoluble marker, and place it in the rack provided by your instructor. You instructor will store the

tubes at –20oC.

Step three

Step one

extract

cheek cellsStep two

Isolate DNAStep three

Amplify (PCR) DNA region

that may or may not have pv-92Step four

electrophoresis to resolve

amplified regions, & analyze

Polymerase Chain Reaction (PCR)

1. Obtain a PCR reaction tube containing a PCR reaction bead

2. Add the following

10l of your own isolated DNA

and

15 l of the primer/loading dye mixture

3. Close the PCR reaction tube lid, and mix the contents. Gently tap the tube on the counter to cause all the liquid to go to the bottom of the tube

4. Place you reaction tube into the thermocycler, and record its location.

Location ______

5. After your instructor starts the 9700 thermocycler, observe one complete cycle. Be thinking about what is occurring at each of the steps in a given cycle. Then, record the temperature for the following:

Denaturation ______

Annealing ______

Extension______

How many cycles is the machine programmed for?______

Once the reaction has started, observe the PCR animation on the computer hooked up to the web!

Once the program has run its course, your instructor will remove the tray containing all the reaction tubes, and will store them in the in the freezer.

Considering that each cell has billions of nucleotides arrayed on 46 chromosomes, how many places will the primers, shown below anneal to?

Notes:

The PCR reaction beads contain

Taq polymerase, a temperature resistant DNA polymerase,
Mg ions needed by the enzyme,
buffer to maintain the correct pH, and
A, T, G, and C nucleotides.

The primer mixture contains two primers, one for the beginning and one for the end of the region to be amplified. The sequences

of these two primers are

5’ AACTGGGAAAATTTGAAGAGAAAGT, and 5’ CTCAAGAAACAGAAGCCCTGTCACC

Step four

Step one

extract

cheek cellsStep two

Isolate DNAStep three

Amplify (PCR) DNA region