Additional Table1.Ultrasound measurements and carcass quality parameters for Angus × Simmental biopsied steers (n= 30 from cows that received a low (LPN), medium (MPN) or high (HPN) plane of nutrition during the late gestation period. Weaning times are early weaning (EW) and normal weaning (NW).Significant differences are declared at P < 0.05.

Treatments / P value
EW / NW
LPN / MPN / HPN / LPN / MPN / HPN / SEM / W / D / W*D
Ultrasound measurements
BF at EW (cm) / 0.31 / 0.35 / 0.33 / 0.31 / 0.35 / 0.34 / 0.02 / 0.81 / 0.13 / 0.92
BF at NW (cm) / 0.33 / 0.34 / 0.38 / 0.32 / 0.32 / 0.32 / 0.02 / 0.14 / 0.38 / 0.65
Marbling at EW / 427 / 389 / 376 / 428 / 413 / 400 / 28 / 0.50 / 0.38 / 0.89
Marbling at NW / 330 / 400 / 342 / 365 / 427 / 421 / 14 / 0.16 / 0.26 / 0.77
Carcass quality parameters
HCW (Kg) / 340 / 359 / 373 / 323 / 336 / 351 / 17 / 0.11 / 0.16 / 0.97
Calculated YG / 3.15 / 3.21 / 2.94 / 3.09 / 2.94 / 3.03 / 0.23 / 0.65 / 0.83 / 0.71
LM area (cm2) / 77.34 / 81.9 / 87.91 / 78.3 / 79.64 / 83.64 / 3.69 / 0.54 / 0.11 / 0.78
Marbling score / 418 / 586 / 486 / 478 / 500 / 484 / 49 / 0.82 / 0.17 / 0.34
Back fat thickness (cm) / 1.24 / 1.38 / 1.29 / 1.32 / 1.17 / 1.13 / 0.13 / 0.39 / 0.85 / 0.53
KPH (%) / 2.11 / 2.03 / 2.07 / 2.35 / 2.12 / 2.11 / 0.11 / 0.16 / 0.30 / 0.63
Days to harvest / 367 / 371 / 387 / 392 / 407 / 387 / 11 / 0.03 / 0.67 / 0.26

Additional Table 2. Animal performance at the feedlot of biopsied Angus × Simmental steers (n = 30) from cows that received different diets during the late gestation period. Diets (D) are cow low plane of nutrition (LPN), medium plane of nutrition (MPN) and high plane of nutrition (HPN). Weaning times (W) are early weaning (EW) and normal weaning (NW). BW = body weight, BF = back fat thickness, ADG = average daily gain, 0 days = beginning of administration of finishing diet, overall dry matter intake (DMI) = from 0 to 140 days in the feedlot. Weaning age × diet interaction (W*D). Significant differences are declared at P < 0.05.

Treatments / P Value
EW / NW
LPN / MPN / HPN / LPN / MPN / HPN / SEM / W / D / W*D
Feedlot Performance
Hip Height (cm) / 112 / 113 / 111 / 106 / 108 / 111 / 2 / 0.05 / 0.73 / 0.47
BW at EW (Kg) / 100 / 104 / 104 / 99 / 106 / 109 / 6 / 0.62 / 0.45 / 0.93
BW at NW (Kg) / 217 / 231 / 245 / 173 / 159 / 192 / 15 / 0.01 / 0.21 / 0.64
BW at 0 d (Kg) / 258 / 278 / 290 / 212 / 204 / 233 / 17 / 0.01 / 0.25 / 0.68
BW at 28 d (Kg) / 308 / 335 / 354 / 253 / 247 / 288 / 20 / 0.01 / 0.11 / 0.67
BW at 56 d (Kg) / 362 / 402 / 410 / 304 / 310 / 350 / 22 / 0.01 / 0.09 / 0.66
BW at 84 d (Kg) / 417 / 453 / 459 / 360 / 365 / 410 / 23 / 0.01 / 0.12 / 0.63
BW at 112 d (Kg) / 462 / 494 / 496 / 408 / 410 / 457 / 23 / 0.01 / 0.17 / 0.54
BW at 140 d (Kg) / 507 / 541 / 557 / 461 / 459 / 507 / 27 / 0.01 / 0.15 / 0.71
Final BW (Kg)* / 548 / 580 / 601 / 521 / 542 / 566 / 27 / 0.11 / 0.16 / 0.97
ADG (0 – 28 d) / 1.76 / 2.03 / 2.28 / 1.49 / 1.56 / 1.96 / 0.18 / 0.02 / 0.03 / 0.83
ADG (29 – 56 d) / 1.96 / 2.39 / 2.01 / 1.80 / 2.25 / 2.22 / 0.18 / 0.84 / 0.05 / 0.49
ADG (57 – 84 d) / 1.95 / 1.81 / 1.75 / 2.01 / 1.94 / 2.14 / 0.14 / 0.09 / 0.72 / 0.44
ADG (85 – 112 d) / 1.61 / 1.50 / 1.32 / 1.72 / 1.61 / 1.69 / 0.13 / 0.04 / 0.30 / 0.33
ADG (113 – 140 d) / 1.89 / 1.82 / 2.07 / 1.90 / 1.76 / 1.79 / 0.19 / 0.46 / 0.68 / 0.70
Overall DMI (Kg) / 14.7 / 17.5 / 16.3 / 15.3 / 15.8 / 18 / 0.8 / 0.72 / 0.04 / 0.11

*Based on 62% dressing percentage

1

Additional Table 3.MeasuredmicroRNA sequences, functions and corresponding target genes.

miRNAs / Function / Sequence / Target genes
miR-130a / Anti-adipogenic / CAGTGCAATGTTAAAAGGGCAT / PPARG
miR-34a / Anti-adipogenic / TGGCAGTGTCTTAGCTGGTTGT / SIRT1
miR-369-5p / Anti-adipogenic / ATCGACCGTGTTATATTCGC / ADIPOQ, FABP4
miR-448 / Anti-adipogenic / TTGCATATGTAGGATGTCCCAT / KLF5
miR-181a / Internal Control Gene / AACATTCAACGCTGTCGGTGAGTT / -
miR-let-7a / Internal Control Gene / CGGTGAGGTAGTAGGTTGTATAGTT / -
miR-16b / Internal Control Gene / TAGCAGCACGTAAATATTGGC / -
miR-103 / Pro-adipogenic / AGCAGCATTGTACAGGGCTATGA / PPARG
miR-143 / Pro-adipogenic / TGAGATGAAGCACTGTAGCTCG / PPARG, CEBPA, FABP4
miR-21-5p / Pro-adipogenic / TAGCTTATCAGACTGATGTTGACT / PTEN, PDCD4
miR-27 a/b / Pro-adipogenic / TTCACAGTGGCTAAGTTCTGC / PPARG, CEBPA
miR-378 / Pro-adipogenic / ACTGGACTTGGAGTCAGAAGGC / PPARG

1

Additional Figure 1.Pro-adipogenic and anti-adipogenicmicroRNA and its targets relative mRNA abundance percentage (n=30)

1

Additional Figure 2.Pro-adipogenic and anti-adipogenic microRNA and its selected target genes expression at 78 days of age of Longissimus muscle for Angus × Simmental steers from cows that received a low (LPN), medium (MPN) or a high (HPN) plane of nutrition (diet) during the late gestation period.Weaning was not considered in the analysis. Different letters denote differences due to cow plane of nutrition. Significant differences are declared at P < 0.05.

Additional Figure 3.MicroRNA targets fold expression due to time effect from microarray analysis at 78, 187 and 354 days of age of Longissimus muscle for Angus × Simmental steers. Black bars represent time comparison 78 - 187 days of age, light gray bars for comparison 187 - 354 days of age and dark gray bar for comparison 78 - 354 days of age. White hatched bars denote not significant differences (P > 0.05). Significant differences are declared at P < 0.05 and FDR < 0.10.

1