SUPPLEMENTAL MATERIAL

Material and Methods.

Materials. Six Stock6-derived inducers were used in present study, CAU5 (Li et al., 2009) and CAUB73 (Dong, 2014) (also named as B73-inducer) with HIR about 10%, an introgressed line obtained by crossing CAU2 (an inducer line with HIR=8%) and B73 followed by two backcrosses with B73 and six selfing generations, resulting in BC2F6 with approximately 80% B73 background and 20% CAU2 background. Another four inducer lines (CAUHOI, UH400, 4644, 4643) were also used in this study. Two single hybrids ZhengDan958 (ZD958) and JingKe968 (JK968) were planted as the female parents to test the HIR of transgenic knockout lines.

Sequence analysis of the PCR-amplified products of GRMZM2G471240. ~300 inbred lines from a subset of a association mapping panel containing ~500 diverse regular maize inbred lines (Yang et al., 2011) and 180 teosinte accessions were used for GRMZM2G471240 sequencing analysis. Six Stock6 derived inducer lines (CAU5, CAUHOI, UH400, 4644, 4643, B73-inducer) were also used for GRMZM2G471240 sequencing analyisis.

BAC library construction and BAC sequencing. DNA of inducer CAU5 was extracted and used for bacteria artificial chromosome (BAC) library construction. BAC library was constructed as described (Woo et al., 1995). Two markers (Dong et al., 2013) flanking the mapping region and 4 newly developed STS markers were used for positive clone screening (Supplementary Table 3). One BAC clone containing GRMZM2G471240 was sequenced and assembled by used the public method (IBGSC, 2012).

Gene editing. CRISPR/Cas9 system was used to knockout the candidate gene of GRMZM2G471240 (Xing et al., 2014). Guide RNA was designed in the first exon of GRMZM2G471240, (Supplementary Table 3) and inserted into vector pBUE411. The vectors with high knocking out efficiency, as tested in tissue culture, were used to generate transgenic plants as follows. Agrobacterium-mediated transformation of young embryos of the receptor inbred was conducted. More than 8000 embryos were used for transformation. Herbicide-resistant plants were selected during callus and seedling stages. T0 transgenic plants were identified by both bialaphos (bar) strip test and sequencing of the candidate gene GRMZM2G471240, plants with positive bar strip test result and sequence mutations in the target region were chosen and self-pollinated to generate T1.

Identification of haploid plants and field expriments. Three T1 transgenic lines with different mutations in the target region were planted in the field. Each plant was genotyped by targeted sequencing (Supplemental Table 3), heterozygous and homozygous mutants wereself-pollinated. In addition, pollen of each mutant plants was applied to at least two ears of hybrid ZD958 and JK968. Wild type receptor inbred lines were separately used to pollinate pollinated to ZD958 and JK968 as control. T1 self-pollinated ears and F1 ears obtained by test-crossing with ZD958, JK968were scored for aborted kernel frequency as described previously (Xu et al., 2013), EnAR(Endosperm Aborted kernel Rate, %) = (the number of endosperm aborted kernels/total kernel number of the ear)×100%. Progenies of T1 transgenic plants and progenies of ZD958×T1, JK968×T1 were planted in the field and visually screened for putative haploids.

Flow cytometry analysis. Flow cytometry was used to determine the ploidy of putative haploids (Schutte B et al., 1985) Young leaves of diploid (control), true haploids (control) and putative haploids were sampled and analyzed with flow cytometry. Samples with the same result of diploids were deemd as diploids, while samples with the same result as true haploids were deemed as haploid. Haploid induction rate was calculated with the formula HIR(%) = (the number of haploid plants/total number of plants derived from one ear)×100%. In order to determine the origin of haploid chromosomes, one polymorphic InDel marker was used to screen the transgenic knockout lines, ZD958/JK968 and the identified haploids and diploids.

RNA-sequencing of B73 and B73-inducer. In maize, the closed sessile and pedicelled spikelets usually share the same developmental stage. Each spikelet contains two florets. The three stamens of a floret are usually at the same developmental stage. To analyze transcriptomes at different developmental stages, three staments of pedicelled floret, and the three staments of sessile florets, close to the analyzed pedicelled florets, were fixed using Carnoy's Fluid and the developmental stages were determined microscopically. In the B73 and B73-inducer lines, 24 and 26 sequencial samples (three staments of a floret for each sample) were collected for RNA extraction. RNA-seqeuncing were performed on Hi-Seq 2000 platform (Illumina, San Diego, US). Reads mapping and expression level calling was based on Tophat (Trapnell et al., 2012).

Supplemental Bibliography.

Dong, X., Xu, X.W., Miao, J.K. Liu, C.X., Tian, X.L., Melchinger, A.E. and Chen, S.J. (2013) Fine mapping of qhir1 influencing in vivo haploid induction in maize. Theor. Appl. Genet. 126: 1713-1720.

Dong, X. (2014) Fine mapping haploid induction rate gene qhir1 in maize and marker assisted selection of qhir1 in haploid breeding in maize (in Chinese). Dissertation, China Agricultural University.

International Barley Genome Sequencing Consortium. (2012) A physical, genetic and functional sequence assembly of the barley genome. Nature 491: 711-716.

Li, L., Xu, X.W., Jin, W.W., and Chen, S.J. (2009). Morphological and molecular evidences for DNA introgression in haploid induction via a high oil inducer CAUHOI in maize. Planta 230:367-376.

Schutte, B., Reynders, M. M.J., Bosman, F.T. and Blijham, G.H. (1985) Flow cytometric determination of DNA ploidy level in nuclei isolated from paraffin‐embedded tissue. Cytometry Part A6 : 26-30.

Trapnell,C.,Roberts,A.,Goff,L.,Pertea,G.,Kim,D.,Kelley,D.R.,Pimentel,H.,Salzberg,S.L.,Rinn,J.L.,Pachter,L. (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. NatProtoc. 7:562-578.

Woo, S.S., Rastogi, V.K., Zhang, H.B., Andrew, H.P., Keith, F.S., and Rod, A.W.(1995) Isolation of megabase-size DNA from sorghum and applications for physical mapping and bacterial and yeast artificial chromosome library construction. Plant Mol. Biol. Reptr. 13: 82-94.

Xing, H.L., Dong, L., Wang, Z.P., Zhang, H.Y., Han, C.Y., Liu, B., Wang, X.C., and Chen, Q.J. (2014) A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC plant bio. 14: 327.

Yang, X.H., Gao, S.B., Xu, S.T., Zhang, Z.X., Prasanna, B.M., Li, L., Li, J.S. and Yan, J.B. (2011) Characterization of a global germplasm collection and its potential utilization for analysis of complex quantitative traits in maize. Mol. Breeding 28, 511-526.

SUPPLEMENTAL TABLES

Table S1. Genes in the mapping region (243kb) based on B73 Reference.

Gene ID(V3) / Gene Type / Gene Annotation / Transcript start / Transcript end / Note*
GRMZM2G544129 / transposable element / No annotation / 68,212,317 / 68,212,440 / low confidence
GRMZM2G544135 / Pseudogene / RPS3 Family / 68,222,864 / 68,223,078 / low confidence
GRMZM2G703616 / Protein coding / Cullin-like protein1 / 68,244,339 / 68,247,633 / low confidence
GRMZM2G471240 / protein coding / Patatin-like phospholipase / 68,240,862 / 68,242,656 / Important
GRMZM2G062320 / protein coding / Histidine phosphatase superfamily / 68,318,898 / 68,321,409 / Important
GRMZM2G062313 / Proteincoding / Patatin and PLA2 superfamily / 68,331,590 / 68,332,624 / low confidence
GRMZM2G062304 / transposable element / No annotation / 68,372,828 / 68,373,823
AC213048.3_FG003 / No annotation / 68,406,503 / 68,406,631 / low confidence
GRMZM2G520395 / Pseudogene / No annotation / 68,412,722 / 68,413,434 / low confidence
AC213048.3_FGT002 / Pseudogene / No annotation / 68,417,549 / 68,418,166 / low confidence
GRMZM2G047877 / Pseudogene / No annotation / 68,423,591 / 68,424,841 / low confidence
GRMZM2G047843 / protein coding / 2-isopropylmalate synthase 1 / 68,426,889 / 68,428,986 / low confidence
GRMZM2G510681 / No annotation / 68,428,105 / 68,428,219 / low confidence

*based on the annotation of MaizeGDB

Table S2. Sequence variation of exons in GRMZM2G471240.

Position(from 5’UTR) / type / SNP / Codon / Amino acid change
B73 / CAU5 / B73 / CAU5 / B73 / CAU5
409 / SNP / C / T / CAC / TAC / H(His) / Y(Tyr)
421 / SNP / C / G / CAG / GAG / Q(Gln) / E(Glu)
441 / SNP / T / C / TTT / TTC / F(Phe) / F(Phe)
887 / SNP / T / G / GCT / GCG / A(Ala) / A(Ala)
1210 / SNP / G / C / AAG / AAC / K(Lys) / N(Asn)
1306 / SNP / T / C / GGT / GGC / G(Gly) / G(Gly)
1435 / SNP / G / A / CTG / CTA / L(Leu) / L(Leu)
1471 / SNP / C / A / GCC / GCA / A(Ala) / A(Ala)
1541 / SNP / A / C / AGG / CGG / R(Arg) / R(Arg)
1572 / Insertion / CGAG / frameshift
1588 / SNP / T / C
1591 / SNP / C / A

Table S3. Primers for plant identification in haploid and T1 stage. Target sequence for CRISPER/CAS9.

Objective / Name / Sequence (5’-3’)
Haploid origin identification / Haploid-F / TGCGAGATGGCGAGTGAGTAG
Haploid-R / CATGGTGCGGATTGGTGTCG
Transgenic plant determination / ZmHIR1/2/3-F / CCCTCGACGAGTATCTATAGC
ZmHIR1/2/3-R / GAAGATGATAGGCTGCAGC
CRISPER/Cas9 / Target sequence / GCTGCAGGAGCTGGACGGACCGG
Positive BAC clone screening / 1-L / GTTATGCCCGTCTGAATCGT
1-R / CAACCAATGGCACCCATATT
41-L / GCCAAGGACATCAACCACTT
41-R / GTTGGCGTCTTCAGTCTGG
131-L / CCTGGCGATGTAGTCGAAGT
131-R / CCTTGCGTTGAATTTTCCAT
207-L / CACGATGTGCAGTGTGAGAA
207-R / CAATGGAAGGGAATCTCCAA

Table S4. The frequency of endosperm aborted (EnAR) kernels in the selfing ears of T1 transgenic plants, wild type and the F1 hybrids (ZD958 and JK968 as female respectively).

Materials / No. of Ears / Total / Average EnAR(%) / Significance
T1 / 20 / 5870 / 14.30±0.43 / **
Wild type / 18 / 5012 / 2.37±0.13
ZD958 × T1 / 18 / 6110 / 10.25±0.27 / **
ZD958 × wild type / 29 / 11786 / 2.38±0.12
JK968 × T1 / 18 / 6467 / 9.05±0.21 / **
JK968 × wild type / 42 / 14352 / 2.80±0.08

** P<0.01

Table S5. Haploid plant identification using three T1 knockout lines as male.

Male Parent / Allele Status / Female Parent / Number of investegated plants / Putative haploids / Origin / HIR(%)
ZmHIR1-1 / Heterozygous / ZD958 / 54 / 1 / Maternal / 1.85
JK968 / 50 / 1 / Maternal / 2.00
ZmHIR1-2 / Heterozygous / ZD958 / 93 / 2 / Maternal / 2.15
JK968 / 57 / 2 / Maternal / 3.51
Self-Pollination / 27 / 1 / 3.70
ZmHIR1-3 / Homozygous / ZD958 / 256 / 4 / Maternal / 1.56
Self-Pollination / 30 / 2 / 6.67
Receptor line / Wild type / ZD958 / 306 / 0 / 0
JK968 / 187 / 0 / 0