Cochliomycin A inhibits the larval settlement of Amphibalanus amphitrite by activating the NO/cGMP pathway
Kai-Ling Wanga,b,e, #, Gen Zhang c, #, Jin Sund, Ying Xub,e, Zhuang Hane,f , Ling-Li Liuc, Chang-Lun Shaoa, Qing-Ai Liua, Chang-Yun Wanga, *, Pei-Yuan Qianc,e, *
a Key Laboratory of Marine Drugs, The Ministry of Education of China, School of Medicine and Pharmacy, Ocean University of China, Qingdao, 266003, China
b College of Life Science, Shenzhen University, 3688 Nanhai Ave, Shenzhen, 518060, China
c Environmental Science Program, School of Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong SAR, China
d Department of Biology, Hong Kong Baptist University, Hong Kong SAR, China
e Division of Life Science, Hong Kong University of Science and Technology, Clear Water Bay, Hong Kong SAR, China
f Sanya Institute of Deep-sea Science and Engineering, Chinese Academy of Sciences, 62 Fenghuang Road, Sanya, 572000, China
#: Co-first authors
*: Co-corresponding authors
* Corresponding author:
Dr. Pei-Yuan Qian
Tel: 0852-2358-7331
Fax: 2358-1559
E-mail:
Contents
Figure S1. 1H and 13C NMR spectra (CDCl3) of cochliomycin A
Figure S2. HREIMS spectrum of cochliomycin A
Figure S3. A simplified schematic of NO/cGMP (cyclic GMP) pathway (Zhang et al. 2012)
Table S1. Primers used for real-time PCR in this study
Table S2. The detailed information of proteins changed in response to cochliomycin A treatment
Figure S1. 1H NMR spectrum (CDCl3) of cochliomycin A
Figure S2. HREIMS spectrum of cochliomycin A
Figure S3. A simplified schematic of NO/cGMP (cyclic GMP) pathway (Zhang et al. 2012)
Zhang Y, He L-S, Zhang G, Xu Y, Lee On.-On, Matsumura K, Qian P-Y. 2012. The regulatory role of the NO/cGMP signal transduction cascade during larval attachment and metamorphosis of the barnacle Balanus (= Amphibalanus) amphitrite. J Exp Biol. 215:3813–3822.
Table S1. Primers used for real-time PCR in this study
Gene / Primer direction / Primer sequence (5’3’)HSP90 / Forward / TACTCACTACTTGGGGCCGA
HSP90 / reverse / TAGAAACGAGAGAGGGGCGA
GC / Forward / AGAGACGTACGAGTCGGTCA
GC / reverse / TACAGCGCGTTCAGAAGTGA
AK / Forward / CTGGGCTTCCTGACCTTCTG
AK / reverse / CCACCTCCTCCAGCTTCTTC
CAT / Forward / AGCCCGTCTACTGCAAGTTC
CAT / reverse / GGGTTGGAGCCAGAGAGTTC
NagA / Forward / AAGGAAACGCTCCGTGACAT
NagA / reverse / ACTCGTCAGTCTTCAGCGTG
Cyt b / Forward / GGACACTGCATGCTAATGGA
Cyt b / reverse / AGGCAGCAGCCATAGTCAAG
INH-L/CON-24 / INH-M/CON-24 / INH-H/CON-24
NO / Contig / Name / p-Value* Fold change p-Value* Fold change p-Value* Fold change
1 / CL14169.Contig1_Ba_mix / cuticular protein 111, RR-3 family (AGAP006931-PA) / 0.000 / 0.56 / 0.000 / 0.47 / 0.000 / 0.46
2 / CL4955.Contig1_Ba_mix / similar to glutathione S-transferase / 0.000 / 1.82 / 0.000 / 1.49 / 0.000 / 1.42
3 / CL2208.Contig1_Ba_mix / glutathione S-transferase / 0.000 / 1.72 / 0.000 / 1.48 / 0.000 / 1.41
4 / CL389.Contig1_Ba_mix / pacifastin light chain precursor / 0.000 / 0.39 / 0.000 / 0.32 / 0.000 / 0.35
5 / CL1301.Contig1_Ba_mix / GST-N-Metaxin-like protein / 0.000 / 1.65 / 0.000 / 1.51 / 0.000 / 1.54
6 / CL1841.Contig1_Ba_mix / catalase / 0.000 / 1.67 / 0.007 / 1.49 / 0.000 / 1.60
7 / CL6569.Contig1_Ba_mix / hypothetical protein TcasGA2_TC014264 / 0.000 / 3.21 / 0.000 / 2.06 / 0.000 / 1.78
8 / CL200.Contig3_Ba_mix / serine proteinase-like protein / 0.000 / 0.72 / 0.015 / 0.73 / 0.000 / 0.68
9 / CL1583.Contig1_Ba_mix / cytochrome P450 6BK7 / 0.000 / 1.52 / 0.001 / 1.34 / 0.000 / 1.43
10 / CL249.Contig3_Ba_mix / cuticular protein / 0.000 / 0.51 / 0.003 / 0.54 / 0.002 / 0.43
11 / CL166.Contig2_Ba_mix / ACYPI45293 / 0.000 / 0.55 / 0.001 / 0.58 / 0.001 / 0.50
12 / CL3616.Contig1_Ba_mix / 6-phosphogluconate dehydrogenase, decarboxylating / 0.001 / 1.44 / 0.002 / 1.42 / 0.005 / 1.45
13 / CL45.Contig6_Ba_mix / muscle myosin heavy chain / 0.001 / 0.70 / 0.015 / 0.74 / 0.011 / 0.69
14 / CL45.Contig3_Ba_mix / similar to Myosin heavy chain CG17927-PF isoform 3 / 0.001 / 0.67 / 0.005 / 0.69 / 0.009 / 0.66
15 / CL46.Contig1_Ba_mix / novel protein / 0.002 / 0.50 / 0.003 / 0.40 / 0.000 / 0.40
16 / CL2238.Contig1_Ba_mix / phosphate carrier protein, mitochondrial-like isoform 1 / 0.005 / 1.37 / 0.005 / 1.30 / 0.010 / 1.35
17 / CL17.Contig11_Ba_mix / novel protein / 0.005 / 0.53 / 0.001 / 0.54 / 0.000 / 0.41
18 / CL6623.Contig1_Ba_mix / signal peptide peptidase / 0.007 / 1.43 / 0.007 / 1.35 / 0.005 / 1.40
19 / CL778.Contig1_Ba_mix / cuticular protein 111, RR-3 family (AGAP006931-PA) / 0.007 / 0.65 / 0.013 / 0.60 / 0.006 / 0.60
20 / Unigene36762_Ba_mix / erythrocyte binding protein / 0.008 / 0.55 / 0.004 / 0.61 / 0.002 / 0.55
21 / CL6490.Contig1_Ba_mix / novel protein / 0.008 / 0.68 / 0.001 / 0.50 / 0.001 / 0.50
22 / CL1.Contig257_Ba_mix / GF23525 / 0.009 / 0.48 / 0.009 / 0.45 / 0.006 / 0.39
23 / CL7151.Contig1_Ba_mix / cytochrome p450 / 0.010 / 1.55 / 0.001 / 1.32 / 0.002 / 1.36
24 / CL43.Contig3_Ba_mix / tubulin alpha 1-like protein / 0.010 / 1.44 / 0.001 / 1.33 / 0.004 / 1.53
25 / CL992.Contig1_Ba_mix / beta-N-acetylglucosaminidase / 0.013 / 0.47 / 0.014 / 0.40 / 0.013 / 0.39
26 / CL14013.Contig1_Ba_mix / cuticular protein 111, RR-3 family (AGAP006931-PA) / 0.013 / 0.61 / 0.006 / 0.63 / 0.008 / 0.57
27 / CL943.Contig3_Ba_mix / similar to AGAP001425-PA / 0.000 / 1.32 / 0.002 / 1.26 / 0.002 / 1.14
28 / CL339.Contig4_Ba_mix / ATP-citrate synthase-like isoform 1 / 0.000 / 1.32 / 0.001 / 1.30 / 0.001 / 1.31
29 / CL9761.Contig1_Ba_mix / histone 1 / 0.000 / 0.75 / 0.146 / 0.84 / 0.074 / 0.84
30 / CL3524.Contig1_Ba_mix / ribosomal protein S15 / 0.000 / 0.62 / 0.007 / 0.72 / 0.073 / 0.83
31 / CL517.Contig1_Ba_mix / glycotransferase / 0.000 / 1.31 / 0.022 / 1.17 / 0.020 / 1.20
32 / CL3363.Contig1_Ba_mix / histone H1 / 0.001 / 0.66 / 0.000 / 0.63 / 0.038 / 0.69
33 / CL888.Contig1_Ba_mix / Gasp protein / 0.001 / 1.34 / 0.048 / 1.38 / 0.016 / 1.48
34 / CL45.Contig4_Ba_mix / myosin heavy chain / 0.001 / 0.76 / 0.113 / 0.87 / 0.082 / 0.80
35 / Unigene14123_Ba_mix / hypothetical protein DAPPUDRAFT_305875 / 0.001 / 2.17 / 0.105 / 1.30 / 0.142 / 1.23
36 / CL41.Contig2_Ba_mix / GST4 / 0.001 / 1.33 / 0.002 / 1.29 / 0.002 / 1.18
37 / CL16695.Contig1_Ba_mix / erythrocyte binding protein / 0.002 / 0.53 / 0.081 / 0.70 / 0.005 / 0.56
38 / CL7079.Contig1_Ba_mix / 40S ribosomal protein S18-like / 0.002 / 0.71 / 0.001 / 0.78 / 0.008 / 0.80
39 / CL17011.Contig1_Ba_mix / GST / 0.002 / 1.49 / 0.001 / 1.28 / 0.005 / 1.32
40 / CL43.Contig1_Ba_mix / Tubulin alpha-1 chain / 0.003 / 1.32 / 0.000 / 1.26 / 0.002 / 1.38
41 / CL43.Contig4_Ba_mix / minus strand tubulin alpha-1 chain / 0.003 / 1.33 / 0.000 / 1.27 / 0.002 / 1.40
42 / CL10654.Contig1_Ba_mix / TPA: TPA_exp: ADP/ATP translocase / 0.005 / 1.47 / 0.019 / 1.48 / 0.009 / 1.53
43 / CL43.Contig5_Ba_mix / alpha tubulin-like / 0.004 / 1.35 / 0.000 / 1.25 / 0.002 / 1.41
44 / CL16531.Contig1_Ba_mix / profilin / 0.006 / 0.73 / 0.136 / 0.82 / 0.015 / 0.74
45 / CL43.Contig7_Ba_mix / tubulin alpha-1 chain-like isoform 1 / 0.006 / 1.32 / 0.002 / 1.27 / 0.007 / 1.38
46 / CL8485.Contig1_Ba_mix / ras-related protein Rab-35-like / 0.006 / 1.35 / 0.041 / 1.21 / 0.063 / 1.26
47 / CL129.Contig2_Ba_mix / Filamin-B / 0.005 / 0.74 / 0.007 / 0.81 / 0.010 / 0.73
48 / CL13907.Contig1_Ba_mix / ribosomal protein S25 / 0.006 / 0.71 / 0.122 / 0.82 / 0.052 / 0.77
49 / CL6516.Contig1_Ba_mix / GK25049 / 0.007 / 1.35 / 0.044 / 1.21 / 0.043 / 1.29
50 / CL587.Contig1_Ba_mix / ribosomal protein S30 / 0.004 / 0.76 / 0.026 / 0.84 / 0.102 / 0.90
51 / CL912.Contig1_Ba_mix / similar to Rab-protein 1 CG3320-PA / 0.007 / 1.34 / 0.024 / 1.22 / 0.012 / 1.28
52 / CL104.Contig1_Ba_mix / ADP/ATP translocase / 0.007 / 1.46 / 0.021 / 1.44 / 0.012 / 1.49
53 / CL179.Contig4_Ba_mix / ADP/ATP translocase / 0.008 / 1.49 / 0.026 / 1.51 / 0.013 / 1.60
54 / CL17573.Contig1_Ba_mix / Glutathione S-transferase / 0.008 / 1.47 / 0.001 / 1.31 / 0.022 / 1.31
55 / CL475.Contig2_Ba_mix / neuroblast differentiation-associated protein AHNAK-like / 0.008 / 0.66 / 0.040 / 0.73 / 0.012 / 0.65
56 / CL15361.Contig1_Ba_mix / histone H2B / 0.008 / 0.69 / 0.001 / 0.80 / 0.000 / 0.81
57 / Unigene35406_Ba_mix / ADP-ATP translocator / 0.010 / 1.45 / 0.011 / 1.40 / 0.037 / 1.39
58 / Unigene11602_Ba_mix / arginine kinase-like / 0.009 / 0.75 / 0.038 / 0.81 / 0.061 / 0.82
59 / CL20.Contig14_Ba_mix / tropomyosin fast isoform / 0.012 / 0.70 / 0.054 / 0.79 / 0.008 / 0.68
60 / CL20.Contig13_Ba_mix / tropomyosin-2 isoform 2 / 0.015 / 0.69 / 0.059 / 0.78 / 0.011 / 0.67
61 / CL8049.Contig1_Ba_mix / ADP-ribosylation factor 1 / 0.015 / 1.67 / 0.028 / 1.45 / 0.043 / 1.39
62 / CL283.Contig1_Ba_mix / preprotein translocase secy subunit (sec61) / 0.015 / 1.43 / 0.004 / 1.35 / 0.016 / 1.52
63 / CL2238.Contig2_Ba_mix / phosphate carrier protein, mitochondrial-like / 0.018 / 1.34 / 0.011 / 1.34 / 0.017 / 1.38
64 / CL10145.Contig1_Ba_mix / Tubulin alpha-1 chain / 0.000 / 1.23 / 0.000 / 1.31 / 0.003 / 1.32
65 / CL200.Contig2_Ba_mix / novel protein / 0.186 / 0.88 / 0.000 / 0.68 / 0.085 / 0.75
66 / CL68.Contig2_Ba_mix / settlement inducing protein complex / 0.001 / 0.80 / 0.000 / 0.70 / 0.001 / 0.73
67 / CL6259.Contig1_Ba_mix / Hsp90 / 0.002 / 1.28 / 0.001 / 1.31 / 0.000 / 1.42
68 / CL5556.Contig1_Ba_mix / Chromosome 14 open reading frame 149 / 0.111 / 1.17 / 0.001 / 1.33 / 0.000 / 1.19
69 / CL202.Contig3_Ba_mix / GA28568 / 0.353 / 0.91 / 0.007 / 0.67 / 0.005 / 0.64
70 / CL918.Contig1_Ba_mix / alpha-aminoadipic semialdehyde dehydrogenase-like / 0.033 / 1.13 / 0.007 / 1.32 / 0.027 / 1.30
71 / CL14503.Contig1_Ba_mix / Cytochrome coxidase polypeptide IV / 0.045 / 1.31 / 0.010 / 1.33 / 0.066 / 1.39
72 / CL15897.Contig1_Ba_mix / AGAP010464-PA / 0.039 / 1.25 / 0.013 / 1.30 / 0.026 / 1.31
73 / CL1739.Contig1_Ba_mix / enoyl-CoA hydratase, mitochondrial / 0.187 / 1.13 / 0.014 / 1.31 / 0.415 / 1.15
74 / Unigene21536_Ba_mix / 60S ribosomal protein L10a-like / 0.005 / 1.29 / 0.015 / 1.31 / 0.000 / 1.32
75 / CL15522.Contig1_Ba_mix / ribosomal protein L10Ae / 0.004 / 1.29 / 0.016 / 1.32 / 0.000 / 1.32
76 / CL502.Contig1_Ba_mix / 60S ribosomal protein L10a / 0.005 / 1.29 / 0.016 / 1.30 / 0.000 / 1.32
77 / Unigene28353_Ba_mix / GK14284 / 0.023 / 1.62 / 0.109 / 1.36 / 0.003 / 1.53
78 / Unigene37534_Ba_mix / tubulin alpha-3 chain-like / 0.012 / 1.28 / 0.005 / 1.25 / 0.003 / 1.30
79 / CL423.Contig1_Ba_mix / cuticular protein / 0.036 / 0.86 / 0.005 / 0.83 / 0.007 / 0.75
80 / CL9869.Contig1_Ba_mix / similar to dendritic cell protein / 0.046 / 1.31 / 0.096 / 1.27 / 0.011 / 1.39
1