Supplementary
Fig. 1.Nucleotide sequence of MhGR-RBP1 cDNA and deduced amino acid sequence. RRM at N-terminus is shaded and glycine-rich domain within C-terminus is underlined. Two conserved regions (RNP1 and RNP2) within RRM are underlined and marked below sequence. Predicted protein sequence is shown beneath nucleotide sequence. Numbers at left indicate positions in recovered nucleotide sequence; those at right show amino-acid positioning from N-terminus. Initiation codon (ATG) and stop codon (TAG) are underlined in bold, and stop codon is indicated by asterisk.Arrows indicate primers forcloning cDNA.
Fig. 2. Multiple alignment of amino acid sequences of MhGR-RBP1 and other plant GR-RBP proteins. The plant GR-RBPs used for alignment were MpGR-RBP1 (M. prunifolia, ADG96008), Pa-RRM-GRP1 (Prunus avium, AAL13082), AtGR-RBP7 (A. thaliana, AAD23639), OsGRP3 (Oryza sativa, AAT85299), ZmGR-RBP2 (Zea mays, NP_001151562), CuGR-RBP (Citrus unshiu, BAA92156), GmGR-RBP (Glycine max, AAD48471) and TaGR-RBP (Triticum aestivum, BAF30986). Deduced amino acid sequences were compared via DNAman program. The N-terminal RRM domain and C-terminal glycine-rich domain of GR-RBPs are indicated by red and black dotted lines, respectively, below multiple alignments.Identical amino acid residues are shaded in green. Strongly conserved residues and weakly conserved residues are show in purple and yellow, respectively. Gaps introduced to optimize alignment are indicated by dots. RNP1 and RNP2 motifs are indicated with red boxes. Four β-strands and two α-helices arranged in β1α1β2β3α2β4 fold with side chains are marked with black lines, respectively. Amino acid residue numbers are indicated on the right.
Fig. 3.Comparative phylogenetic analyses of MhGR-RBP1 with apple, Arabidopsis, and rice GR-RBP family proteins. Unrooted tree was inferred by MEGA 4.0 and neighbor-joining method after full-length amino acid sequences of MhGR-RBP1 were aligned with apple,Arabidopsis, and rice members. MhGR-RBP1 is indicated by triangle. Numbers on branches indicate percentage of 1,000 bootstrap replicates that support adjacent node; values <50% are not indicated. GenBank accession numbers for apple,Arabidopsis, and rice GR-RBPs are listed in Table 1.
Table 1 Members of the GR-RBP protein family found in apple, Arabidopsis, and rice
Gene / Identifier / Domains / Size (aa) / Homology (%) / Mass(kDa) / Isolectric point / Localization
MhGR-RBP1 / ADQ08684 / RRM / 164 / 100 / 16.19 / 6.36 / nucleus
MpGR-RBP1 / ADG96008 / RRM / 171 / 96 / 16.69 / 6.36 / nucleus
AtGR-RBP1 / AT2G16260 / RRM / 185 / 50 / 20.05 / 6.16 / chloroplast
AtGR-RBP2 / AT4G13850 / RRM / 158 / 52 / 15.70 / 6.72 / mitochondria
AtGR-RBP3 / AT5G61030 / RRM / 309 / 50 / 29.98 / 4.87 / mitochondria
AtGR-RBP4 / AT3G23830 / RRM / 136 / 53 / 14.13 / 8.68 / nucleus/
mitochondria
AtGR-RBP5 / AT1G74230 / RRM / 289 / 53 / 28.73 / 4.61 / mitochondria
AtGR-RBP6 / AT1G18630 / RRM / 155 / 46 / 15.96 / 9.89 / mitochondria/
cytoplasm
AtGR-RBP7 / AT2G21660 / RRM / 176 / 80 / 16.89 / 5.86 / nucleus/
cytoplasm
AtGR-RBP8 / AT4G39260 / RRM / 169 / 75 / 16.58 / 5.58 / nucleus
AtRZ-1a / AT3G26420 / RRM: C2HC / 245 / 54 / 26.92 / 8.93 / nucleus
AtRZ-1b / AT1G60650 / RRM: C2HC / 292 / 46 / 34.40 / 8.56 / nucleus
AtRZ-1c / AT5G04280 / RRM: C2HC / 310 / 48 / 33.49 / 9.13 / nucleus
OsGRP1 / Os01g68790 / RRM / 150 / 48 / 15.55 / 8.01 / chloroplast
OsGRP2 / Os03g56020 / RRM / 141 / 20 / 16.29 / 8.21 / mitochondria/
cytoplasm
OsGRP3 / Os03g46770 / RRM / 162 / 81 / 15.90 / 6.30 / nucleus
OsGRP4 / Os04g33810 / RRM / 137 / 46 / 15.10 / 9.93 / nucleus/
mitochondria
OsGRP5 / Os05g13620 / RRM / 104 / 53 / 11.49 / 8.03 / nucleus
OsGRP6 / Os12g31800 / RRM / 258 / 56 / 25.04 / 4.74 / nucleus/
mitochondria
OsRZ1 / OS03G61990 / RRM: C2HC / 205 / 57 / 21.82 / 8.29 / nucleus/ mitochondria
OsRZ2 / OS07G08960 / RRM: C2HC / 308 / 56 / 33.25 / 9.31 / nucleus/ chloroplast
OsRZ3 / OS03G47800 / RRM: C2HC / 308 / 48 / 34.04 / 9.05 / nucleus
Table 2Primer sequences and sizes of amplified products for MhGR-RBP1 and reference genes in quantitativereal-time PCR and semi-quantitive RT-PCR
Gene name / Accession number / Primer sequences (5'-3') / Amplicon size(bp)EF-1α / DQ341381 / (F)ATTCAAGTATGCCTGGGTGC / 174
(R)CAGTCAGCCTGTGATGTTCC
actin / GQ339778 / (F)CCAAAGGCTAATCGGGAGAA / 105
(R)ACCACTGGCGTAGAGGGAAAG
18S rRNA / CN995444 / (F)CCTGCCCTACTGCCGCTA / 172
(R)GGAAACACGCAGAATCAATCA
MhGR-RBP1 / HQ380209 / (F) CGTCGTGAGGGTGGCTATG / 119
(R) AAAGTCCCAAACCACCTAACAC