(Supplementary Information)
Enzymatic reporting of peste des petits ruminants virus genes ligating two specific probes on nanoparticles
Chunai Tao•Gang Li•Yong Wang• Huaxin Huang
Sequences of target ssDNA and probes
P1N(5'-NH2-CTCGGACAGGAGATGGTCAGAAGAT-3')
P2G (5'-GGTCAGCTCTGTAATCGCGGC(A)10SH-3')
TN (5'-TGGCCGGAGATCCTGACATCAACGGGTCAAAGCTGACCGGCGTGATG-3')
N115(5'-AGCCAAACTAGTCTCGGAAATCGCCTCACAGACTGGGGATGAACGAACCGTCAGAGGGACTGGGCCTCGACAGGCGCAGGTCTCCTTCCTCCAGCATAAAACAGATGAGGGAGAG-3')
Details of construction of AuNP-P2G and HRP-AuNP-P2G
Synthesis of gold nanoparticles
Gold nanoparticles (AuNP) were prepared according to previous report with minor modifications(Hilland Mirkin. 2006). 1 ml 1% HAuCl4·3H2O solution was mixed with 99 ml ultrapure water, agitated for 5 min, followed by adding 2 ml 1% sodium citrate and boiled for 15 min. Finally, the mixture was filtrated with 0.22 µm nitrocellulose filter and characterized by TEM. According to the molar absorption coefficient (Georganopoulou et al. 2005)
A=εbc, OD520nm=0.6
The deduced concentration of AuNP was approximately 2.2 nM. 250 particles were sized from TEM micrographs via graphics software Image-Pro Express(Media Cybernetics) to calculate the particle diameter. The average particle diameter was 13 nm and the size distribution was 10%within the mean diameter.
Manufacture of AuNP-P2G
Briefly, 1ml AuNP solution was centrifugated to collect the precipitate, followed by adding 3µl P2G(100µM)and 97µl ultrapure water. The solution was left standing at room temperature for 16h before incubated with 100 µl coupling buffer(20mM phosphate buffer, pH7.0 ) for 48h.The AuNP-P2G solution was subsequently centrifugated and washed with ultrapure water. Finally, the sediment was resuspended with 100µl stock solution (10mMphosphate buffer, pH8.3).
Fabrication of HRP-AuNP-P2G
200 µl AuNP-P2G was incubated with 200 µl 10ng/ml HRP at 37℃for 30min, thenrinsed twice with PBS containing 0.02% Tween20 to remove unbound HRP. Finally, the mixture was resuspended with 200 µlhybridization buffer and stored at 4℃.To determinethe amount of HRP in the HRP-AuNP-P2G conjugates, a calibration curve plotting the optical density versus different concentrations of HRP was constructed. TMB-H2O2 was employed to standard HRP and HRP-AuNP-P2G conjugates and 2 MH2SO4 was added to terminatethe reaction. The optical density at 450 nm was recorded. According to the statistics, the concentration of HRP in HRP-AuNP-P2G conjugates wasdetermined to be 2.5 ng/ml (Fig. 1).
Detection curve of ssDNA N115
References
GeorganopoulouDG, Chang L, Nam JM, Thaxton CS, Mufson EJ, KleinWL, MirkinCA(2005)Nanoparticle-based detection in cerebral spinal fluid of a soluble pathogenic biomarker for Alzheimer's disease.P Natl Acad Sci USA 102:2273-2276
HillHD, MirkinCA (2006) The bio-barcode assay for the detection of protein and nucleic acid targets using DTT-induced ligand exchange.NatProtoc1: 324-336
1
