Supplementary Material

Box 1. PCR Conditions and Sequencing

Conventional PCR / A conventional PCR on a final volume of 25 µL was performed containing Buffer 1X, 1 mM or 1.5 mM of MgCl2 depending on the primer pair to be used, 0.2 mM of each primer, 0,25 mM dNTPs, 1U of Taq polymerase (Invitrogen®) and 120 ng gDNA for each reaction. A MyCycler®(BIORAD) thermocycler was used with the following parameters: a first denaturation step at 95ºC, a second 35-cycle step of a 30 second denaturation at 95ºC followed by hybridization for 30 seconds at specific temperatures depending on the primer pair and extension at 72ºC for 40 seconds. Finally, there was an extension step at 72ºC for 10 minutes.
Sequencing / Obtained amplicons were verified by electrophoresis in a 1.7% agarose gel. Amplicon purifications from PCR products were performed using the Pure Link® kit (Invitrogen). For sequencing, 10 µL of purified product and 1.2 µL of primer (forward or reverse) were used. Forward and reverse sequences were analyzed for each amplicon using a Big Dye Terminator 3.1 kit (Applied Biosystems®), according to the manufacturer’s instructions. Reaction products were purified again using a Big Dye XTerminator 3.1 kit (Applied Biosystems®) and were analyzed on an ABI Prism 3500 sequencer (Applied Biosystems). The obtained sequences were analyzed in detail using the BioEdit® Sequence Alignment Editor to verify their quality. To identify mutations, FASTA sequences were compared against a reference genome using the BLASTn tool. The different mutants’ amino acid sequences were obtained using the Translate Tool from Proteomics Tools (ExPASy).

Table 1. Supplementary Material. Conditions for the amplification of gene segments.

Exon / Primer / Sequence / Annealing (ºC) / MgCl2 / Amplicon length (bp) / Reference
1 / 1 F / GCAAAAAGACGGGTAACTGC / 57 / 1.5 / 548 / (Alves et al., 2006)
1R / AGGGAGGAAGGGAGAAGAGA / (Alves et al. 2006)
2 / 2F / AGGACTCAGGCTTCCTCCTC / 56.5 / 1 / 429 / (Lau and Lam 2008)
2R / AACAAGATGTCCCGCACAAT / (Lau & Lam 2008)
3 / 3F / TGGTTTGAGCTCTGCATGAC / 57 / 1.5 / 409 / (Lau & Lam 2008)
3R / AGAGGGCTCTGCAAAGACAG / (Lau & Lam 2008)
4 / 4F / GTTCCACTTGCCCATTTGTT / 57 / 1.5 / 275 / (Alves S. et al. 2006)
4R / ACCAGCTTCACAGAACATGC / (Alves S. et al. 2006)
5 / 5F / CGTGAAGGGCTGATTATGTG / 57 / 1.5 / 393 / (Alves S. et al. 2006)
5R / ATGTAGCCACCTTCCCTGTG / (Alves S. et al. 2006)
6 / 6F / ACGTGGGGAATGCTAGTGAG / 57 / 1.5 / 397 / (Alves S. et al. 2006)
6R / GGTGGAGTTGTGTCTACTGAGAA / (Alves S. et al. 2006)
7 / 7F / GATTGGGAGAGATGCACAGG / 57 / 1.5 / 335 / (Alves S. et al. 2006)
7R / CCACTGGTTCACAAAAGAGAA / (Alves S. et al. 2006)
8 / 8F / ACAAGCTGTGGTATGATGAT / 50.5 / 1 / 280 / (Alves S. et al. 2006)
8R / TAAAGGTGATCTTACTGTCAA / (Alves S. et al. 2006)
9 / 9F / AGGTGGTGTTTCTAAACGTCTG / 57 / 1.5 / 705 / (Alves S. et al. 2006)
9R / CAAAACGACCAGCTCTAACTC / (Alves S. et al. 2006)

Table 2. Supplementary Material. RMSD and ASA calculations for each mutant IDS model, using MOE and Getarea (http://curie.utmb.edu/getarea.html), respectively.

MUTATION AT PROTEIN LEVEL / Phenotype / RMSD (Å) / ASA (Å2 x 104)
Wild type / - / - / 2,15
R468Q / N / 0,18 / 2,30
Q465X / N / 0,28 / 2,24
K347Q / N / 0,13 / 2,60
K236N / N / 0,21 / 2,49
S71N / No N / 0,19 / 2,05
P160S fsX4 / N / 0,38 / 1,30
D190PfsX13 / N / 0,27 / 1,54
P185WfsX23 / N / 0,34 / 1,52
P62QfsX67 / N / 0,17 / 1,20
R294GfsX2
(Del. Exon 7) / N / 0,24 / 1,66
Del Q200_E203(QSTE) / N / 0,62 / 2,54

Table 3. Supplementary Material. Analyses of the interactions of mutant proteins by Docking* (Galvis et al., 2014).

MUTATION / INTERACTIONS
R468Q / The O2-sulfate from the uronic acid of the substrate interacts mainly with Arg 297 to form a hydrogen bond; other electrostatic interactions involved Tyr105 and Asn106. It is of note that Cys84 interacts with O3 but not with the sulfate to be cleaved.
Q465X / No interaction between the ligand and Cys84 was observed in this docking. A hydrogen bond between O-2 sulfate and Asn167 was formed. Other interactions involved Tyr300, Arg297, Leu318 and Phe105.
K347Q / On docking, the O-2 sulfate of the uronic acid forms hydrogen bonds with Asp45 y Arg297.
K236N / Similar interactions to those observed with K347Q, but without the formation of hydrogen bonds.
S71N / Docking results were very similar to those of wild type, with the exception of the hydrogen bonds between O-2 sulfate and Arg297 and Asp45.
Del Q200_E203 / Electrostatic interactions of O-2 sulfate with Leu240, Tyr165 and Cys84.
R294GfsX2 (Del. Exon 7) / Cys 84 interacts electrostatically with the carboxyl group of IdoA/GlcA instead of the O-2 sulfate.

*The novel frameshift mutations (P160fsX4, D190fs13, P185GfsX2 and P62QfsX67) lack most of the catalytic site and have less than 203 amino acids (representing less than 50% of the protein), thus molecular docking has no utility for these cases, and was not performed (Figure 4, supplementary material).

SUPPLEMENTARY FIGURES LEGENDS

Figure 1 Supplementary Material. Wild type IDS model. Yellow, IDS model; blue, template (1AUK). RMSD between model and template was 0.97 Å. Pymol v1.3.

Figure 2. Supplementary Material. Wild type IDS docking. Wild type hIDS docking interactions involve O-2 sulfate of glucuronic acid (GlcA) with Cys84, Tyr165, Leu244 and Arg297. Electrostatic interactions were also seen between carboxyl group of GlcA and Asn106. In the external portion of the pocket, three hydrogen bonds were observed between a different GlcA monomer, Leu189 and Asp187(Galvis et al., 2014). Pymol v1.3.

Figure 3. Supplementary Material. IDS mutant docking (Galvis et al., 2014). Pymol v1.3. For a detailed description, see Table 3 in this supplementary material.

Figure 4. Supplementary Material. Truncated novel mutants. Green, D190Pfs13X; blue, P185GfsX2; magenta, P160fsX4. Note the severe geometrical distortion of these structures and the large number of coils. Pymol v1.3.

1