Bioethanol productionby heterologous expression of

Pdc and AdhII in Streptomyces lividansTK24

Journal name: Applied Microbiology and Biotechnology

Jae Sun Leea,Won-Jae Chib, Soon-Kwang Hongb, Ji-Won Yanga,c,and Yong Keun Changa#

aDepartment of Chemical and Biomolecular Engineering, Korea AdvancedInstitute of Science and Technology, 373-1, Guseong-dong, Yuseong-gu, Daejeon, 305-701, South Korea

bDivisionof Bioscience and Bioinformatics, Myongji University, San 38-2 Namdong, Yongin, Gyeonggido, 449-728, South Korea

cAdvanced Biomass R&D Center, 373-1, Guseong-dong, Yuseong-gu, Daejeon, 305-701, South Korea

# Corresponding author:

Yong Keun Chang,

Department of Chemical and Biomolecular Engineering, Korea AdvancedInstitute of Science and Technology, 373-1, Guseong-dong, Yuseong-gu, Daejeon, 305-701, South Korea

TEL +82-42-350-3927, FAX +82-42-350-3910

Table S1. Strains and plasmids used

Designation / Relevant characteristics / Source or Reference
Strains
S. lividans TK24 / Str-6 / John Innes Centre, UK
E. coli DH5α / supE44ΔlacU169(Ø80lacZΔM15)
hsdR17 recA1 endA1 gyr96 thi-1 relA1 / Stratagene
E. coli ET12567 / dam-13::Tn9 dcm-6 hsdS cat tet / MacNeil et al. 1992
Plasmids
pUC18 / pMB1 ori ampr / Genescript USA Inc
T & A vector / lacZ, T-cloning flank, ampr / Real Biotech Corporation
pUWL201PW / High-copy, tsrr, ampr, E. coli-Streptomycesexpression vector / Doumith et al. 2000
pHSEV-1 / High-copy, tsrr, ampr, E. coli-Streptomycesexpression vector / This study
pUWL201PW-pet / 2.9-kb fragment containing codon-optimized pdc and adhII inserted into the NdeI-BamH1 site of pUWL201PW / This study
pUWL201PW-Tpet / 3.0-kb fragment containing codon-optimized pdc, tipA promoter, and codon-optimized adhII inserted into the NdeI-BamH1 site of pUWL201PW / This study
pUWL201PW-Zpet / 2.9-kb fragment containing pdc and adhII from Zymomonas mobilis inserted into the NdeI-BamH1 site of pUWL201PW / This study

Table S2. Primers used for thepet operon and Tpet module construction

Primer / Target gene / Sequence (5'→ 3')
1 / F-pdc / catatgatgtcctacaccgtcggcacctac
2 / R-pdc / ctgcagtcacaggagcttgttgac
3 / F-adh II / catatgatggcctcctcgaccttctac
4 / R-adh II / ggatcctcagaaggccgagaggaacagctc
5 / F-RBS +adh II / ctg cag gag gag cat atg atg gcc tcc tcg acc
6 / R-RBS +adh II / gga tcc tca gaa ggc cga gag gaa cag
7 / F-Zpdc / cat atg atgagttatactgtcggtacc
8 / R-Zpdc / ctg cag tta gag gag ctt gtt aac agg ctt acg
9 / F-ZadhII / cat atg atggcttcttcaactttttat
10 / R-ZadhII / gga tcc tta gaa agc gct cag gaa gag
11 / F-RBS +ZadhII / ctg cag gag gag cat atg atggcttcttca
12 / R-RBS+ ZadhII / gga tcc tca gaa gga tcc tta gaa agc gct
13 / F-tipA / ctg cag ggg ctg agg gag
14 / R-tipA / ctg cag tcc gct ccc ttc

Figure S1.

Detection of Pdc and AdhII proteins expressed in S.lividans TK24/petby SDS-PAGE.(M, Molecular size marker; 1, S. lividans TK24/pUWL201PW; 2, S. lividans TK24/pet; 3, S. lividans TK24/Zpet;4, S. lividans TK24/Tpet)