1
ALTERNATIVE SPLICING
Textbook: Pages 669-672.
Key words: exon, intron, small ribonucleoprotein particles (SNURPs), spliceosome, DNA splice sites, branch-point DNA sequence, excised intron, lariat, RNAase, intron degradation, alternative splicing, C-terminal domain of RNA polymerase II, recruitment of proteins by the CTD, different patterns of phosphorylation.
Although we only have about 20,000 to 25,000 genes we can make more than a hundred thousand different proteins. This is because more than one type of mRNA from many of our genes due to so-called alternative splicing of the primary RNA transcript from the genes.
From: Wikipedia
The splicing machinery involves both RNA (small nuclear RNA, or snRNA) and proteins. The proteins include the specific proteins that bind to the snRNAs to from the specific small ribonucleoprotein particles (SNURPs) and also a wide variety of regulatory proteins of splicing. Different types of cells in our body (e.g. neurons vs liver cells) contain different sets of these regulatory, with the result that different types of cells have different patterns of alternative splicing. A neat example of this involves the synthesis of different forms of the protein called tropomyosin. This protein is a Ca++ binding protein involved in muscle action in smooth and skeletal muscle. The forms of tropomyosin are different in these two types of cells. The result is that smooth and skeletal muscle cells difference in response to the Ca++ signal. (We will talk about this at later time.) It turns out that other cells also have tropomyosins, but different types. The gene for tropomyosin is the same in all our cells, but because of alternative splicing different mRNAs fro tropomysosin are made in different cell types.
The mechansism of RNA splicing
Splicing has to be completely exact! If the cut between the exon and the intron is off by even one ribonucleotide, then a frameshift error in ribosome reading of the mRNA message (translation) will occur.
Exon #1 Intron Exon #2
Primary mRNA transcript: THECOPSAWGARBAGESAMRUNOUT
Exon #1 Exon #2
Correct mRNA after splicing: THECOPSAWSAMRUNOUT
Exon #1 Exon #2
Incorrect mRNA after splicing: THECOPSAWG SAMRUNOUT
Remember that translation of the mRNA message has two rules:
(1)Read in triplets. The only difference in my example above is that we are using a 24 letter alphabet rather than a four letter alphabet.
(2)Start at the triplet AUG (in our case at “THE”).
Clearly, inserting a G into our sentence renders the reading of our sentence meaningless after THECOPSAW since we have to read our sentence by the “triplet reading” rule.
In the ribosome exact triplet reading of the mRNA is a result of the complementary base-pairing between the anticodons of transfer RNA (tRNA) and the mRNA. Nothing recognizes a specific sequence of RNA better than the complementary sequence of RNA! So what better way to identify the splice exactly than to use a complementary RNA strand!
CACUCC
AUGAUUGCAUCCGUGAGGAUUGCAUCCAUAACAGCAAUGCCAGAGCUACCGC
So one splice site has been “marked”. Like the anticodon “marks” its complementary codon in mRNA. The complementary RNA shown in green above is packaged into a small nucleoprotein particle (SNURP).
CACUCC
complementary RNA sequence to the beginning of the intron
It turns out that the cutting at the first splice site occurs first and froms a rather unexpected RNA molecule called a “lariat” because of its shape.
CACUCC UCCUUAC
AUGAUUGCAUCCGUGAGGAUUGCAUCCAUAACAGGAAUGCCAGAGCUACCGC
The G at beginning of the intron acts as a nucleophilic attacker (remember organic chemistry!) of the A in the branch point sequence of the intron. The branch-pont sequenec in the intron is, of course(!), marked out by a SNURP containing the appopropriate complementary snRNA sequence.
On the next page is a copy of Fig. 21-24 from your texbook.
(1)The U1 snurp, with its RNA complementary to the first ribonucleotides of the intron, binds to the first splice site.
(2)The U2 snurp, with is RNA complementary to the branch-point sequence of the intron, binds to the intron.
(3)Three other snurps pile on, forming the beginning of a spliceosome.
(4)The G nucleophilically “attacks” the A in the branch point sequence, forming a covalent bond.
(5)Then the intron is cut off the second exon.
(6)The two exons are then joined together by a covalent bond.
(7)The intron RNA, now in the form of a “lariat”. The lariat is degraded into its individual ribonucleotides. These are then recyled into new RNA, maybe this time into an exon!
Notice how this mechanism above never results in the dispersal of the exons into the general nucleosome before they are joined together. They are kept close together to ensure they can be joined together.
Role of the CTD of RNA polymerase II
The C-terminal domain (CTD) of RNA polymerase is an amazing example of protein intercation in cells. We have seen that:
(1)Maximum phosphorylation of the CTD results in the release of the polymerase from the transcription factors TFIIB and TFIID, allowing the plymerase to start moving down the DNA template strand.
(2)The methyl–G capping enzyme complex is recruited to the CTD upon a change the phosphorylation pattern of the CTD.
(3) Recruitment of the components of the spliceosome.
The components of the spliceosome (snurps and regulatory proteins) are recruited and assembled on the CTD when the pattern of phosphorylation on the CTD changes yet again.
(1)The methyl-G cap has already been added, so the capping complex is no longer on the CTD.
(2)The “splicing factors” are the snurps and regulatory proteins.
(3)Much of the spliceosome is assembled on the CTD, but it is pushed off before splicing actually occurs in it.
(4)The recruited of the various components of processing of the primary RNA transcript are assebled togther at the right time by being “recruited” to the CTD. Which particular processing components at a given time is determined by the changing phosphorylation state of the CTD.